Page 1 of 1

Protein Coding

Posted: Sun Oct 08, 2006 2:54 am
by xBobbyCx
If

5' ACTTAGGCATGCTGCCATGCAAT 3'

is part of teh sequence of bases on template strand, how do I know the amino acid sequence?

mRNA codon:

3' UGAAUCCGUACGUCGGUACGUUA 5'

tRNA codon:

5' ACUUAGGCAUGCUGCCAUGCAAU 3'

Do I read the mRNA or tRNA and in which direction??

Pls help, I got that as a test question last year but I didnt ask my teacher for the correct answer, I got it wrong. (and she's fierce she would scold so I dare not ask her)

Thanks!!!!

Posted: Sun Oct 08, 2006 8:51 am
by drhamill
This site is meant for students to recieve guidance on science projects and is not intended for general homework help. The question you've asked is important, and you should understand it. However, you should be able to figure it out by reviewing the chapter on transcription and the genetic code in your textbook. You also could ask classmates to explain it to you and even the "fierce" teacher. If you go in with a well formulated question on a problem that you have tried hard to figure out by yourself, most teachers will recognize this and try to help!

The hardest part of your question is keeping the 5' and 3' ends of the nucleic acids straight. Most codon tables are given based on mRNA sequence and are to be used from 5' to 3'. Thus if your mRNA strand, from 5' to 3', starts for example, AUGCUU, you would say the amino acids are Met-Leu. The template strand of DNA, from which this RNA was transcribed, would be 3' to 5'. (RNA polymerase, an enzyme that transcribes RNA from DNA, can only work in the 5' --> 3' direction on the growing RNA strand.)

p.s. Did you hear that Roger Kornberg - who has done a great deal of work on RNA polymerase, won the Nobel Prize in Chemistry earlier this week??

Posted: Tue Oct 10, 2006 2:20 am
by xBobbyCx
The hardest part of your question is keeping the 5' and 3' ends of the nucleic acids straight. Most codon tables are given based on mRNA sequence and are to be used from 5' to 3'. Thus if your mRNA strand, from 5' to 3', starts for example, AUGCUU, you would say the amino acids are Met-Leu. The template strand of DNA, from which this RNA was transcribed, would be 3' to 5'. (RNA polymerase, an enzyme that transcribes RNA from DNA, can only work in the 5' --> 3' direction on the growing RNA strand.)
Hi drhamill, I dont quite understand. DNA is transcribed from 5' to 3', and the mRNA sequence is read 5' to 3' (to get the a.a order). So does this mean I have to read the DNA template from 3' to 5' (cos it's antiparallel)? But this would go against the set 'rule' that DNA must be read from 5' to 3'.

I have a book on that topic, but nothing much is said about the a.a sequence coding. No practices, nothing. All theory, and I do have a problem reading too complicated stuff cos I cant imagine them.



That part that you mentioned,

mRNA:
5' AUGCUU 3'

so the DNA is
3' TACGTT 5' can it also be written 5' TTGCAT 3' ?

(does it matter if the sequence is started at 3' or 5', so long as my bases are written in sequence?)


Thank you very very much. If you could help me here, maybe I'd work my own question out here. Actually my question isnt homework, it was my quiz question from last year. (Cell Bio - now I'm doing Molecular Bio which is also about DNA)

About Roger Kornberg, I didnt read the newspapers, so I didnt know about it. HAha. Thanks for informing me. ;)

Posted: Sat Oct 14, 2006 7:07 am
by drhamill
I'll try to clarify - you said,
"DNA is transcribed from 5' to 3', and the mRNA sequence is read 5' to 3' (to get the a.a order). So does this mean I have to read the DNA template from 3' to 5' (cos it's antiparallel)? But this would go against the set 'rule' that DNA must be read from 5' to 3'. "

Yes, the DNA template used for transcription goes from 3' to 5' as this is the strand of DNA that could make antiparallel RNA that goes from 5' to 3'. I'm not sure what you mean about the "rule" that DNA must be read from 5' to 3' - this is not correct. It is true that the RNA polymerase only puts in RNA nucleotides from 5' to 3', and this is consistent with the template DNA being read from 3' to 5'.

To your second question:

mRNA:
5' AUGCUU 3'
so the DNA is
3' TACGTT 5' can it also be written 5' TTGCAT 3' ?

Answer: YES

(does it matter if the sequence is started at 3' or 5', so long as my bases are written in sequence?)
Answer: NO

Hope this helps.