Science Buddies: "Ask an Expert"

Hi.. I started my project today.. I had being to few plant nursaries to buy native plants with medicinal use. I found out centella asiatica (memory plant), leucas aspera (cough), leucas indica (cough), calotropis procera(fever) to be the most interesting, easily available & cheap at cost.. Can i proceed with my research with these plants..

And i have another doubt.. Can i use a different primers instead of the ones given in sciencebuddies??? i.e.
PCR primers for amplifying rubisco large subunit
Two sets of primers are needed (total of 4 primers):
Primer mix #1
Forward primer 5' ATGTCACCACAAACAGAAAC 3'
Reverse primer 5' CTTCACAAGCAGCTAGTTC 3'
Primer mix #2
Forward primer 5' ATGTCACCACAAACAGAAAC 3'
Reverse primer 5' TCCTTTTAGTAAAAGATTGGGCCGAG 3'
Could you suggest me another Primer mix sequence that will amplify Rubisco enzyme??? Or atleast the method to determine another Primer mix sequence. I am good at PRIMER3 software. How should i go about in getting the specific Primer mix sequence through this software such that it will amplify Rubisco enzyme itself..? Hope i wont go wrong in what i do.. Or do you want me to use the same sequence as given in SceinceBuddies.. I want to publilsh the end result in GenBank.. So i want this to be novel in these aspects.. Hope any one could reply fast..
Thank you..

Please reply whether i should continue with the same primer or can i design my own primer and order it..
I really want this information.. Hope anyone could help me.. Thank you

Hi.. I am in big trouble.. I am stuck with this doubt from 3days Is this the only primer for coding Rubisco as given in ScienceBuddies for this project???
1. Primer mix #1
a. Forward primer 5' ATGTCACCACAAACAGAAAC 3'
b. Reverse primer 5' CTTCACAAGCAGCTAGTTC 3'
2. Primer mix #2
a. Forward primer 5' ATGTCACCACAAACAGAAAC 3'
b. Reverse primer 5' TCCTTTTAGTAAAAGATTGGGCCGAG 3'

Or can there be a different ones also.. If yes,i will find out myself.. i just want to know whether i am goin in the right direction or not...
Please reply before its too late
Thank you

Hi,
Have you been in touch with Chris Baysdorfer (required BEFORE you start yourr project if you hope to use him for free sequencing services- see project idea writeup). You need to ask him about alternative sequence primer oligomers. I say this because I suspect, but do not know, that he is collecting these sequences for his own research. If you use different PCR primer sequences it is likely you will pull out a different sequence segment from your sample. This would make your sequence useless for comparison to other sequences collected in this project, and might be a waste of his time and resources.

As to the originality of your plant candidates, I don’t have an answer, though you could look at samples already collected to see if there are any duplicates documented. I think the odds are low of a duplication, as the original focus of this project was to survey California native plants. You may want to survey this website:

http://www.ebbep.org/docs/pcr/chloroteacher.pdf

Which has teacher resources for another aspect of this research project. It has some really great links in it, as well as lots of background info. Here is a related project:

http://babec.org/files/pdf/mtDNA_student09.pdf

This paper addresses why a study of genetic variation might be important:

http://www.springerlink.com/content/lc2 ... lltext.pdf

http://ukpmc.ac.uk/articlerender.cgi?to ... d=18664299

I hope ypu find this information helpful.

Best regards,

Barrett L. Tomlinson

Thank you Barrett L. Tomlinson..
This information really was of great help..
I will email Chris Baysdorfer to find out about different primers..
But i have already made arrangements for sequencing services in INDIA itself as i live here..
Thanks a million tons sir for your time..
SCIENCEBUDDIES ROCKS!!!