Page 1 of 2
cAMP regulation (cont.)
Posted: Tue Nov 01, 2005 4:20 pm
by mmb11
What I am doing is trying to clone a gene (cpdA) in E coli that encodes a cAMP-specific phosphodiesterase, meaning I want to reduce the cAMP concentration. Then I want to insert multiple copies of this gene back into the E coli. In addition to the gene insertion, I want to stop the activation of Adenylate Cyclase to produce cAMP by somehow stripping the cell of the activator (which I haven't figured out how to yet). After, I will measure the b-galactosidase concentration using X-gal.
This is all an effort to control b-gal production by regulating cAMP concentrations.
I need some way of isolating AND cloning the gene as well as inserting it back in.
Thank you
Posted: Tue Nov 01, 2005 6:43 pm
by Sareena Avadhany
Hello mmb11,
I google scholared your project, and received interesting links. Unfortunately, none of them exactly answered your question. Here is what I found:
http://www.mcponline.org/cgi/reprint/M2 ... P200v1.pdf - this is for isolating cpdA
http://www.jbc.org/cgi/content/full/271/41/25423 - I found this to be very informative and quite relevant to your project.
Try scholar.google.com. In the search box, type in what you want to find, and google scholars will give you published works on your topic, or similar to it.
Hope this helps,
Sareena
Posted: Wed Nov 02, 2005 12:26 pm
by jenniferpaulson
Hi,
This article explains how growing E. coli in the presence of certain sugars (glucose) can inhibit the activity of adenylyl cyclase (the enzyme that makes cAMP).
http://www.pnas.org/cgi/content/abstract/71/6/2324
Hope that helps!
Jennifer
Posted: Thu Nov 03, 2005 12:21 pm
by phamlinh
Hi there,
That's a really interesting molecular biology project you've got there. I'm assuming due to the level of detail that you've described that you're working in a university lab. Is this correct? If not, please let me know and I'll offer more specific guidance.
First, I wanted to point you to a website dealing with cloning:
http://www.ncbi.nlm.nih.gov/books/bv.fc ... apter.1536
This is an online chapter from a standard college-level genetics textbook. It covers the basics of cloning and may help you. It may also help to clarify responses that you get. If you're confused about any details, please let me know.
Based on your project description, I'm going to write out my response using molecular biology terminology. If you don't understand anything, review it in the Griffiths book link I listed above (you can search it on that website), and PLEASE ASK ME QUESTIONS!
To isolate your gene of interest, you need to find an organism that expresses cpdA. I'm assuming that some strains of E. coli express it. Design primers to the genomic sequence and PCR it up to amplify it. Then you will put it into a vector and transform it into E. coli. I think having multiple copies of the gene is a good idea, but this can be difficult to monitor. Can't you get the same effects by putting the gene under the control of a very strong promoter? This should overexpress the gene according to your specifications.
I haven't worked on adenylate cyclase in E. coli specifically. Are null mutant bacteria lacking adenylate cyclase viable? I'm suspicious that they might not be. I did a google search for "adenylate cyclase inhibitor". The Sigma website (where many scientists order their chemicals) has a list of adenylate cyclase inhibitors. You will want to research how they work, and then choose at least two for your experiment. That may be easier than knocking out adenylate cyclase (which may kill the bacteria) AND cloning in your gene. This way, you just have to clone cpdA.
Here's the sigma website:
http://www.sigmaaldrich.com/Area_of_Int ... _to_C.html
You can search around the website or Pubmed to find out how the enzymes work.
I hope this was helpful. If you have any questions at all, please let me know.
Good luck!
Linh
Posted: Fri Nov 04, 2005 1:31 pm
by mmb11
Hello Lihn,
I am wary of posting too much more information about myself on this forum. I would like to get some more help and being able to explain mor in depth about myself and my project. Is there any way I can email you? If so how can I get your email address without either of us having to display on this forum? I hope you can help!
Thanks
Posted: Fri Nov 04, 2005 2:22 pm
by phamlinh
Greetings,
I'm very glad that your cautious about posting too much information about yourself in this public forum.
There are a couple options that I can think of off the top of my head. One possibility is to email Science Buddies and get someone to mentor you on a higher level project. I believe they are starting to do things along these lines.
Alternatively, I can still give advice on this forum as long as it is general. For example, you could tell me that you could tell me that you're working with a university without telling me which one it is. Or you could list the general area (for example, I work in the Bay Area) without it being too personal.
Regardless, I cannot give you my personal email address. We will either converse directly over this forum, or you can be paired with someone through Science Buddies and work with them over a slightly different, more private bulletin board forum. This is the best way to protect all people involved.
I hope this makes sense and that it's helpful. If you have any more questions, please respond here, or feel free to email the Science Buddies organizers. They're terrific and are great at helping students in your situation.
Best of luck,
Linh
Posted: Fri Nov 04, 2005 5:00 pm
by mmb11
Ok. I have found what I need for cloning and inserting the gene back into the bacteria, but now my trouble is isolating the gene. How do I find a way to isolate the very specific gene (cpdA) I want?
Thanks
Posted: Sat Nov 05, 2005 6:48 pm
by phamlinh
Hi there,
What organism expresses cpdA? Is its genome sequenced? If it's a common lab strain or model organism, in all likelihood its genome is sequenced.
Let's review the basic molecular biology steps.
You need to isolate this specific gene, amplify it by PCR, clone it, and then transform your E. coli to express it. Please ask me questions if you're unsure of any of these steps.
Based on your post, it sounds like you're stuck at the PCR stage. First, figure out the genetic source of cpdA that you're interested in. For example, if you're transforming E. coli, the easiest thing to do would be to find out if E. coli expresses cpdA and clone the native version of the gene. To do this, find out the genetic sequence of cpdA (look at Pubmed or similar websites that have DNA sequences), design primers specific for cpdA, and then perform PCR to amplify up the gene.
That's the general strategy you'll want to take. If you need help with specific aspects, please let us know and we'll answer the question. I'm not sure at which particular point you are stuck. Also keep in mind that you'll want a way of checking that your primers are specific to your gene of interest and a way of verifying that the PCR product is probably then one that you want. I can explain these in detail if you're confused.
Hope this is helpful. Let me know if I need to clarify any points.
Best of luck,
Linh
Posted: Sun Nov 06, 2005 4:59 pm
by carolinethorn
Hi,
Linh had some great points there.
I think from your last reply that you needed help with designing the PCR reaction to amplify and isolate your cpdA. As linh said you need to get the DNA sequence for your gene but also consider the PCR and cloning process.
There are some good general rules for designing PCR reactions. Wikipedia has a pretty good overview of PCR
http://en.wikipedia.org/wiki/Polymerase_chain_reaction
this website is about using PCR to clone a gene
http://wine1.sb.fsu.edu/bch5425/lect24/lect24.htm
this is about desgning primers
http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi
So once you find the sequence for your cpdA and you decide how you are going to clone it into the vector (see reference 2, blunt end, TA or restriction site) then design the primers and PCR conditions.
If you like you can post your cpdA sequence and suggested primers on the board I can check them for you before you order them.
good luck,
-Caroline
Posted: Mon Nov 07, 2005 5:17 pm
by mmb11
http://www.ncbi.nlm.nih.gov/entrez/quer ... ids=947515
this is all I could find as far as the DNA sequence of cpdA in E coli. Can someone help me figure out what and where the sequence is? Or maybe point in a specific direction of the sequence on another website?
Thank you
Posted: Mon Nov 07, 2005 5:30 pm
by carolinethorn
This is a good place to start from as it has links to various information on cpdA. If you scroll down to the part about genomic regions, transcripts and products it has a link to the RefSeq sequence NC_000913. Click there and it takes you to the nucleotide sequence for cpdA.
If you view the genbank version of the file, it has annotations on NC_000913 to indicate where the sequence of cpdA is. (From 1 to 828 on the sequence shown at the bottom of the file. )
NB: If you select to view the file in FASTA format it makes it easier to cut and paste it into a primer design program.
good luck with designing the primers.
-Caroline
Posted: Mon Nov 07, 2005 5:37 pm
by phamlinh
Hi there,
Just in case you get confused about which link Caroline is referring to, here's a copy of the link. It's directly linked to the NCBI Sequence Viewer webpage and contains the genetic sequence of cpdA.
http://www.ncbi.nlm.nih.gov/entrez/view ... =2&dopt=gb
By the way, another great resource is the E. coli genome project. I'm posting the link to their ASAP database:
http://www.genome.wisc.edu/tools/asap.htm
You can search for specific genes, such as cpdA. Here's a link to the weblink if you perform a search on cpdA.
https://asap.ahabs.wisc.edu/asap/featur ... 1107235959
I hope this is helpful. Best of luck.
Linh
PS: In case it hasn't be mentioned before, a good primer design program is called Primer3. Googling should take you to many links with the program.
Posted: Tue Nov 08, 2005 4:56 pm
by mmb11
I believe I have my primers deisgned using the Primer3 program, assuming that the sequences on Pubmed are 5'->3'. Now I have a few question about some of the aspects of PCR.
-On the Wikipedia explanation of PCR, they give an example of it being done. In order to to "melt" the DNA and primers, the heated it at 96*C. Is this standard for all DNA, or just specific to the example?
-As I understand it, I need to extract the DNA from the E. coli to use it as the DNA template. Is this correct?
-One of the materials I need for PCR is a buffer solution. Are there specific chemical concentrations that I need to calculate for my specific experiment, or is there a general buffer solution I can use?
-After I have performed PCR, I will have the primers, the new copies of the gene I want, and the original DNA template will all be mixed in one solution. To separate them, I will perform Agarose gel electrophoresis. Is this correct?
I think these were all of my questions that I had concerning PCR.
Thank you.[/i]
Posted: Tue Nov 08, 2005 7:37 pm
by phamlinh
Greetings,
Congrats on designing your primers! That's a great first step. If you'd like the experts to check over them for you, feel free to post them here. Here's also some general instructions you can follow yourself.
You will want to perform a BLAST search on your primers (specific nucleotide-nucleotide, or BLASTn). This program will compare your genetic sequence (in this case, your primers), and pull up other similar sequences. You want to make sure that for both of your primers, the cpdA gene is the top hit in E. coli.
Here's a link to the BLASTn webpage on NCBI:
http://www.ncbi.nlm.nih.gov/BLAST/Blast ... QUENCE=yes
Choose the nr database (which includes everything sequenced) and just pay attention to the E. coli hits. Paste a primer in the box and click on the Blast button. You'll want to repeat with your other primer as well. If this doesn't make sense, please feel free to ask us. Only pay attention to the E. coli hits. Alternatively, change the database to E. coli. I didn't notice this option when I played with it though (it would restrict any returns to only those present in the E. coli genomic sequence, which is all you would care about).
Also note that there is a BLAST search on the E. coli genomic database, but you have to register for the site (it is free though).
Q1: As you mentioned, there are three steps to PCR: denaturing, annealing (also called melt temp, but this is different from what you described below), and extension. A temperature around 96 or 97 degrees is standard for all PCRs because this is a temperature where the strands of DNA will separate but the polymerase (the enzyme that incorporates nucleotide base pairs) will still be active. The annealing temperature will depend on your specific primers. If you ordered your primers, it should have the annealing temperature (also listed as melt temp) listed on the sheet. Otherwise, post your primers and we will help you determine the annealing temp. Typically, the extension temperature is around 72 or so, but it depends on which type of polymerase you're using.
Q2: You are correct. You will need to extract genomic DNA from the E. coli to use a DNA template. If you have problems, let us know and someone will definitely be able to post a protocol that will work for you. I would also speak with your mentor. (By the way, do you have a university mentor or not?) I've done colony PCR before where I've used a little bit of an individual colony as template for my PCR reaction, but that was usually for high copy plasmids. I'm not sure if your genomic DNA would be sufficiently abundant to serve as a template without extracting it first. Check with your mentor though...it all depends on your particular reaction.
Q3:Each type of polymerase comes with its own type of buffer. So, once you decide with polymerase to use and order it, a tube of PCR reaction buffer will come it. Each enzyme is slightly different, so slightly different buffers are used. If you need help choosing a polymerase, let us know. The most standard one is Taq, a heat-stable (remember the 97 degree step) polymerase present in thermophilic bacteria.
Q4: You're thinking very carefully here. That's awesome. You're correct: you'll have all three things in one tube. However, only the primers and the PCR product will be present in abundance. Moreover, if your PCR worked efficiently, you typically don't see a primer band. It's easy to distinguish them because you can compare them to the molecular weight ladder that you will run as a control on your gel. This will let you know where to expect a band that should correspond to your product. Typically, you cannot see the template on an agarose gel. You can purify the PCR product from the gel (called gel purification; there are kits to do this). Gel purification also gets rid of other things, like the buffer and the polymerase enzyme.
Do you have a PCR machine to perform these reactions for you?
It sounds like you're thinking about your project very carefully. That's really great. Please post if you have any more questions.
Best of luck.
Linh
Posted: Tue Nov 08, 2005 9:47 pm
by mmb11
When I do a BLAST search of my primers, I don't even get a hit for the cpdA gene. However I do get quite a few hits for different E coli genes. I am thinking that the source stating the gene sequence has it listed in 3'->5' order instead of the other way around. Is this my possible problem? What else could my problem be?
Thank you
Posted: Wed Nov 09, 2005 1:04 pm
by phamlinh
Hi there,
The sequence was definitely listed 5' to 3'. Why don't you list your primers and we can work from there? It's a little hard to tell without seeing them.
Also, did you put in any parameters into Primer 3? That would also be useful.
Linh
Posted: Wed Nov 09, 2005 1:20 pm
by mmb11
here is a link to my primer3 results:
http://frodo.wi.mit.edu/cgi-bin/primer3 ... esults.cgi
By the way, I am not at a University. I am still in high school and in the process of getting in touch with the man in charge of the lab at the community college in this town. When I do, I will know if he has a thermal cycler and such.
Thank You
Posted: Wed Nov 09, 2005 3:13 pm
by phamlinh
Greetings,
The link you posted didn't work. In general, when a link ends with .cgi, it means its a program running to post the result, and generally a copied link will not work. When I click on the link, I just get a program error. Can you please paste the primer sequences on this website?
Thanks for letting me know your research situation. If you there is a university located anywhere near you (other than city college), I would highly recommend that you get in contact with them. The experiments that you want to do are trivial in terms of a lab budget, but quite expensive for an individual to perform. For example, a reaction set of Taq polymerase (the standard enzyme used for PCR) runs around $100 at least. Its sufficient enyzme to do around 200 reactions, but you'll probably only do a few at most. So if you can contact a lab at a university, it's only 50 cents for you to run your experiment (trivial amount of money to them), but it would be really expensive for you to do on your own. If there are any biotech companies around, I would also strongly suggest finding out whether someone would be willing to mentor you.
Otherwise, I think city college is a good idea as well. The problem is that community colleges don't have that big of a budget. Try to find the instructor for some class that teaches laboratory technique. There are community college courses that teach basic lab skills and may have the equipment that you need.
Good luck.
Linh[/u]
Posted: Wed Nov 09, 2005 3:58 pm
by mmb11
Primer3 Output
No mispriming library specified
Using 1-based sequence positions
OLIGO start len tm gc% any 3' seq
LEFT PRIMER 601 20 60.03 45.00 4.00 3.00 tgcggtcatattcatcagga
RIGHT PRIMER 815 20 60.07 50.00 2.00 2.00 gaagcggtatcaggttggaa
SEQUENCE SIZE: 828
INCLUDED REGION SIZE: 828
PRODUCT SIZE: 215, PAIR ANY COMPL: 3.00, PAIR 3' COMPL: 2.00
1 ttggaaagcctgttaacccttcctctggctggtgaggccagagtcaggattttacaaatt
61 accgacactcacctgtttgcacaaaagcacgaagccctgttaggggtaaacacctgggag
121 agttaccaggcggtgctggaggcgattcggccacaccagcacgaattcgacctgattgtc
181 gcgacaggtgatttagcgcaggatcaatcctctgcggcctatcagcatttcgctgaaggc
241 atcgcaagttttcgtgcgccctgcgtctggctgccgggcaaccacgatttccagcccgcg
301 atgtacagcgcgttacaggatgcgggtatctccccggcgaagcgcgtgtttattggtgag
361 caatggcaaatcctgttgctggatagccaggtgtttggcgtgccgcacggtgagctgagc
421 gagtttcagcttgagtggctggaacgtaaactggccgatgcgccagaacgccatacgttg
481 ctgctgctgcatcatcatccgctacctgcgggttgtagttggctcgatcaacacagtctg
541 cgtaacgcgggcgaactggataccgtgctggcgaagtttccgcacgtcaaatacttgctg
601 tgcggtcatattcatcaggagctggatctcgactggaatggtcgccgcctgctggcaacg
>>>>>>>>>>>>>>>>>>>>
661 ccgtcgacctgtgtgcagtttaagccgcactgttccaactttacgctggataccatcgcg
721 cccggctggcgtactctcgagttacatgctgatggcacgctgaccaccgaggtgcatcgc
781 ctggcggacacacgtttccaacctgataccgcttcagaaggctactga
<<<<<<<<<<<<<<<<<<<<
KEYS (in order of precedence):
>>>>>> left primer
<<<<<< right primer
ADDITIONAL OLIGOS
start len tm gc% any 3' seq
1 LEFT PRIMER 615 20 60.10 55.00 4.00 2.00 tcaggagctggatctcgact
RIGHT PRIMER 815 20 60.07 50.00 2.00 2.00 gaagcggtatcaggttggaa
PRODUCT SIZE: 201, PAIR ANY COMPL: 3.00, PAIR 3' COMPL: 1.00
2 LEFT PRIMER 596 20 60.10 45.00 4.00 2.00 tgctgtgcggtcatattcat
RIGHT PRIMER 815 20 60.07 50.00 2.00 2.00 gaagcggtatcaggttggaa
PRODUCT SIZE: 220, PAIR ANY COMPL: 3.00, PAIR 3' COMPL: 1.00
3 LEFT PRIMER 573 20 60.12 45.00 4.00 2.00 gaagtttccgcacgtcaaat
RIGHT PRIMER 815 20 60.07 50.00 2.00 2.00 gaagcggtatcaggttggaa
PRODUCT SIZE: 243, PAIR ANY COMPL: 4.00, PAIR 3' COMPL: 2.00
4 LEFT PRIMER 375 20 60.14 55.00 8.00 1.00 gttgctggatagccaggtgt
RIGHT PRIMER 615 20 60.10 45.00 4.00 0.00 atgaatatgaccgcacagca
PRODUCT SIZE: 241, PAIR ANY COMPL: 5.00, PAIR 3' COMPL: 2.00
Posted: Wed Nov 09, 2005 4:29 pm
by carolinethorn
Hi,
Wow, you have really made some ground since i checked the board - good job!
I can see why your blast for the primers was not that favourable. For some reason the product size is only a part of your sequence of interest (from 601 to the end), when you really want the primers to amplify the whole thing.
Unfortunately I am not familiar with how the Primer3 program works - I am old fashioned and usually design my primers by hand. Its kind of hard to explain how to do that over the message board but i could try. Let me know.
did you decide how you were going to clone cpdA into the vector? as this makes a difference with how you would design the primers, if you want a restriction enzyme sequence in them.
-Caroline
Posted: Thu Nov 10, 2005 1:30 pm
by mmb11
I would like to try to design my primers by hand, but I am not able to find a website that goes into much detail about it. Can you either post a website or instructions if it is not too difficult to explain?
Thank you
Posted: Thu Nov 10, 2005 1:52 pm
by carolinethorn
This is going to get long and complicated because i don't have a good website for this and am used to doing this face to face with my students. But i'll give it a try. I am going to post a couple of tasks for you to do. we will start with "draft primers", then move on to making sure they would be a good primer pair, and then are in a format where you could order them from a company.
So a couple of general things about designing primers are that they need to be long enough to be specific to what you are trying to amplify, but not too long to make the annealing temperature too high (temperature at which the primer will bind to the template DNA). Both forward (or left as they called it on primer3) and reverse (right) need to be able to anneal at the roughly same temperature as its happening at the same time in the reaction tube.
The forward primer is going to copy the strand of DNA that is the same as the sequence you have. The reverse primer is going to copy the other strand. So the forward primer will match EXACTLY to the beginning of your gene.
I start with about the first 18 bases of sequence and write that down on paper, lets call this draft forward primer. (leave room both left and right of it so you can add to later)
what is your draft forward primer?
The reverse primer is more tricky because we have to think about the other strand, that is not shown on our sequence. But we know what the other strand bases are because they have to be the complementary or watson and crick pairs of the sequence we have.
So that last few bases of your cpdA sequence is
gcttcagaaggctactga
what is the complement of this sequence?
Posted: Sat Nov 12, 2005 2:34 pm
by mmb11
My draft foward primer is: ttggaaagcctgttaacc
My complimentary sequence of the last 18 bases is: cgaagtcttccgatgact
Thank you
Posted: Sat Nov 12, 2005 6:28 pm
by carolinethorn
Great!
The next step is to work out the approximate Tm or temperature at which these will anneal. The easiest formula for Tm is (number of As and Ts)x2 plus (number of Cs and Gs)x4 = annealing temperature in C. [The Cs and Gs have more hydrogen bonds to pair across the strands so it increases the temparature more than the As and Ts]
If they match or are only 1C different thats great. If not start adding/taking away bases from the end of the draft forward primer and the beginning of the draft reverse primer. You want to aim for a temperature around 55-65C
-Caroline
Posted: Sun Nov 13, 2005 11:26 am
by mmb11
"If not start adding/taking away bases from the end of the draft forward primer and the beginning of the draft reverse primer."
I am confused on what exactly you mean. I understand that I will want to add or take away bases if the Tm's aren't within 1C of each other, but does that mean I will add bases to the foward primer while taking away bases from the reverse primer? Or am I the adding to or taking away bases from both the foward and reverse primers?
My questions are a little confusing. Maybe you can clarify this sentence a little more.
Thank you
Posted: Sun Nov 13, 2005 12:44 pm
by carolinethorn
Sorry, what i put was confusing. I was trying to convey that there is some tinkering to do.
But since the length of the primer determines its specificity i wouldn't want the primers to be less than 18 bases in length, and the Tms are lower than 55C i would start by adding a base to each.
Then i would add another base to the primer that had a lower Tm and recalculate, and so on.
Posted: Sun Nov 13, 2005 2:23 pm
by mmb11
My new primers are:
Foward: ttggaaagcctgttaaccct
reverse: gcgaagtcttccgatgact
They both have an annealing temp of 58*C
Posted: Sun Nov 13, 2005 2:36 pm
by carolinethorn
great!
now that last things are to check is that they won't form primer dimers. primer dimers occur when the 3' end of the forward primer is complementary to the 3' end of the reverse primer.
and try doing a blast to see what sequences they pull up.
And the final thing is to write out the primers 5' to 3' as this is the way most companies ask them to be written for ordering or how you would write them in a paper. (The draft forward primer is already 5' to 3' but the draft reverse primer is currently 3' to 5')
Posted: Sun Nov 13, 2005 3:13 pm
by mmb11
This time when I do a BLAST search, both of my primers are the fourth E. coli hit down.
How do I work with this?
Thank you
Posted: Sun Nov 13, 2005 4:06 pm
by carolinethorn
what are the hits above cpdA?