Science Buddies: "Ask an Expert"

Hi everone. I was wondering whether anyone had any suggestions for this project of mine.

I have to design some primers to perform a semi-quantitative PCR. Here is the cDNA of interest:

atgaattcag tgacgaaaat cagcacactg ctcatcgtga ttttatcctt tctctgttttgtggagggtc tgatctgtaa ttcatgtgaa aagtcacgag attcaagatg tacaatgccacaaagcagat gcgttgcaaa acctggtgaa tcatgcagta ccgtatcaca ctttgttggaacaaagcatg tgtactcaaa gcaaatgtgc tcgcctcagt gcaaggaaaa acagcttaacactggaaaga agttgattta cataatgtgc tgcgaaaaaa acttgtgtaa tagcttctagatggagaaga atcactcgaa gatcatcttc tgttcaagat ccaaacttac aaatgaatcaagatggggaa cttgctttcc tactcgattt ccatgatggc ctgagatccc tgagatagcaacagaggctg tgtcctcgtt tcagtgaaag acttcttgac cacaccatta gagcactgcaaaaaaaaaaa aaaaaaaaaa

Now I was given these primers, which is suppose to be specific for the gene of interest :

5' -> 3'
Forward: : 5’ATGATTCAGTGACGAAAT3’; and
Reverse: 5’GAAGCTATTACACAAGTTTT3’.

However, when I try and design the primer by hand...I get two completely different primers. Are the above primer sequence wrong...or is it just me?

Thanks in advance for all your help.

Genotype wrote:Hi everone. I was wondering whether anyone had any suggestions for this project of mine.

I have to design some primers to perform a semi-quantitative PCR. Here is the cDNA of interest:
<snip>
Thanks in advance for all your help.

Genotype, you might get an answer from our more knowledgeable biology folks in next days after Thanksgiving holiday... but FYI, this forum is principally a forum for K-12 students working on Science Projects. A volunteer staff monitors this forum (and mentors other students more actively in teams). As a post-doc researcher, sounds like you could be a mentor! check it out!

Best wishes,

Ceal Craig
Ask An Expert Forum
Science Buddies

Hi Genotype,

It looks like there may be a typo either in the forward primer or in your cDNA of interest - there appears to be an extra A in the cDNA sequence listed.

cDNA: atgaattcagtgacgaaaat
forward primer: atgattcagtgacgaaaat

When I looked for the reverse primer I found it at the end of the 4th line and the start of the fifth line
end of 4th: aaaacttgtgtaatagcttc

Since it is a reverse primer it is of course the complementary bases running in the opposite direction. Also it looks like the primers that you were given are not for the whole stretch of DNA that you were given. This is fine because it is usually better to have shorter PCR products as they often give more effecient amplification reactions. In any case you would not design a PCR product for the poly A tail at the end of the gene as it would make a very poor primer.

I hope this helps!

Donna Hardy

Thanks everyone for replying!

Ceal Craig: I initially joined this website to see whether I could help with any problems the students had...since my expertise is with cell culture and cell-based molecular biology...and then I had to do PCR and then realise the last time I did PCR was 6 years ago
I will definitely be staying on this board to help with any other science-related questions. Unfortunately, since I live in Australia that is probably the only thing I can do. I wish I could become a volunteer!

Donna: Thanks a bunch! You are absolutely right, there was a typo in the forward primer. I approached my supervisor about this since the primers that I got was the same as his except for the forward primer. So its a type with the forward primer.

Thanks everyone for your help!!!!!