CHLOROPLAST SEQUENCING
Moderators: AmyCowen, kgudger, MadelineB, Moderators
-
KIRAN DEEPIKA
- Posts: 83
- Joined: Sun Jan 17, 2010 3:33 am
- Occupation: Student:12th grade
- Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
- Project Due Date: April 20, 2010
- Project Status: I am conducting my experiment
CHLOROPLAST SEQUENCING
Hi, i am immensely interested in the Chloroplast Genome Sequencing of Native plants Project. Can you please give me more information related to the project. Also please let me know why specifically Chloroplast is chosen here. And what are the Applications of this project.. Please reply soon.. Thank you 
-
deleted-71925
- Former Expert
- Posts: 15
- Joined: Fri Nov 20, 2009 5:01 pm
- Occupation: Student: 11th grade
- Project Question: Biology
- Project Due Date: N/A
- Project Status: I am finished with my experiment and analyzing the data
Re: CHLOROPLAST SEQUENCING
Hi, correct me if I'm wrong but I believe you are referring to this science buddies project
https://www.sciencebuddies.org/science- ... 5&from=TSW
Now to the question answering part....
This links talks a lot more about the enzyme that is being analyzed
http://www.pnas.org/content/97/24/12937.full.pdf
The links on the project should be helpful if you have questions about the techniques that will be used.
The chloroplast enzymes are probably used as a simple way of comparing DNA. Instead of sequencing an entire genomic sequence, the scientist can focus on sequencing a smaller part which will show evolutionary differences. By understating plant evolution scientists can sometimes find new ways of using plants. For example if a plant is found to have a anti-bacterial propriety but the plant is in short supply, a plant that is evolutionary similar might have this prosperity.
Hope you research goes well
Adam
https://www.sciencebuddies.org/science- ... 5&from=TSW
Now to the question answering part....
This links talks a lot more about the enzyme that is being analyzed
http://www.pnas.org/content/97/24/12937.full.pdf
The links on the project should be helpful if you have questions about the techniques that will be used.
The chloroplast enzymes are probably used as a simple way of comparing DNA. Instead of sequencing an entire genomic sequence, the scientist can focus on sequencing a smaller part which will show evolutionary differences. By understating plant evolution scientists can sometimes find new ways of using plants. For example if a plant is found to have a anti-bacterial propriety but the plant is in short supply, a plant that is evolutionary similar might have this prosperity.
Hope you research goes well
Adam
-
KIRAN DEEPIKA
- Posts: 83
- Joined: Sun Jan 17, 2010 3:33 am
- Occupation: Student:12th grade
- Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
- Project Due Date: April 20, 2010
- Project Status: I am conducting my experiment
Re: CHLOROPLAST SEQUENCING
Thanks a million tons adamg
I will get back when i hav more queries during the course of the project
I will get back when i hav more queries during the course of the project
-
donnahardy2
- Former Expert
- Posts: 2671
- Joined: Mon Nov 14, 2005 12:45 pm
Re: CHLOROPLAST SEQUENCING
Hi Kiran,
I noticed that you started a new topic on the website. It's better to continue on the same topic so all of the experts that are following your inquiries will be copied on your replies.
I don't think we can answer the question about which native plant you should use for this project, because we don't know what native plants you have available to test. India is a big place and I'm sure there are different native plants in different areas. Ideally, you would select a plant that hasn't been sequenced before. You can check on the Genbank website, http://www.ncbi.nlm.nih.gov/Genbank/, and search for the names of plants that you might want to test. Here is an interesting website that lists flowers found in India:
http://www.flowersofindia.net/
This is a very interesting project. Good luck!
Donna Hardy
I noticed that you started a new topic on the website. It's better to continue on the same topic so all of the experts that are following your inquiries will be copied on your replies.
I don't think we can answer the question about which native plant you should use for this project, because we don't know what native plants you have available to test. India is a big place and I'm sure there are different native plants in different areas. Ideally, you would select a plant that hasn't been sequenced before. You can check on the Genbank website, http://www.ncbi.nlm.nih.gov/Genbank/, and search for the names of plants that you might want to test. Here is an interesting website that lists flowers found in India:
http://www.flowersofindia.net/
This is a very interesting project. Good luck!
Donna Hardy
-
KIRAN DEEPIKA
- Posts: 83
- Joined: Sun Jan 17, 2010 3:33 am
- Occupation: Student:12th grade
- Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
- Project Due Date: April 20, 2010
- Project Status: I am conducting my experiment
Re: CHLOROPLAST SEQUENCING
Thanks for your valuable time, Donna Hardy..
I will look into your links..
I will look into your links..
-
KIRAN DEEPIKA
- Posts: 83
- Joined: Sun Jan 17, 2010 3:33 am
- Occupation: Student:12th grade
- Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
- Project Due Date: April 20, 2010
- Project Status: I am conducting my experiment
Re: CHLOROPLAST SEQUENCING
I loved the Idea of combining wet lab and dry lab in this project.. But my project should be more Application oriented.. Can you please give me more applications of this project..
I am starting this tomorrow in my college.. So i want more literature based on this..
I am starting this tomorrow in my college.. So i want more literature based on this..
-
donnahardy2
- Former Expert
- Posts: 2671
- Joined: Mon Nov 14, 2005 12:45 pm
Re: CHLOROPLAST SEQUENCING
Hi Kiran,
By applications oriented, does that mean that your project has to have a practical application? If so, this project could have a very practical application because it may help identify genes that provide drought tolerance or salt tolerance, for example, so could help with genetic engineering of plant crops in the future.
Otherwise, it's difficult to recommend a project for you. Since you are just starting, perhaps you should go back to the science buddies website and try selecting another topic that would meet the requirements of your assignment and that you are interested in doing.
https://www.sciencebuddies.org/science- ... deas.shtml
Donna Hardy
By applications oriented, does that mean that your project has to have a practical application? If so, this project could have a very practical application because it may help identify genes that provide drought tolerance or salt tolerance, for example, so could help with genetic engineering of plant crops in the future.
Otherwise, it's difficult to recommend a project for you. Since you are just starting, perhaps you should go back to the science buddies website and try selecting another topic that would meet the requirements of your assignment and that you are interested in doing.
https://www.sciencebuddies.org/science- ... deas.shtml
Donna Hardy
-
KIRAN DEEPIKA
- Posts: 83
- Joined: Sun Jan 17, 2010 3:33 am
- Occupation: Student:12th grade
- Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
- Project Due Date: April 20, 2010
- Project Status: I am conducting my experiment
Re: CHLOROPLAST SEQUENCING
I have done a paper presentations in waste water treatment in our college's INTERNATIONAL CONFERENCE OF BIOTECHNOLOGY the previous year..
This year i want to do this project..
I hav done projects on extraction of pectin from apple.
Caffeine From Tea Waste.
Alcohol From Potatoes.
Acetic Acid From Molasess.
And METHYLATED SPIRIT FROM SUGAR CANE MOLASSES got me the 1st prize in the inter college fest.
So i am not a beginner. I made up my mind to do this project itself 15 days ago, Donna hardy..
This is amazing.. I will be starting with CHLOROPLAST SEQUENCING tommorow for sure..
I will get back to you during the course of my project..
Thanks tons for your time, Donna Hardy..
This year i want to do this project..
I hav done projects on extraction of pectin from apple.
Caffeine From Tea Waste.
Alcohol From Potatoes.
Acetic Acid From Molasess.
And METHYLATED SPIRIT FROM SUGAR CANE MOLASSES got me the 1st prize in the inter college fest.
So i am not a beginner. I made up my mind to do this project itself 15 days ago, Donna hardy..
This is amazing.. I will be starting with CHLOROPLAST SEQUENCING tommorow for sure..
I will get back to you during the course of my project..
Thanks tons for your time, Donna Hardy..
-
donnahardy2
- Former Expert
- Posts: 2671
- Joined: Mon Nov 14, 2005 12:45 pm
Re: CHLOROPLAST SEQUENCING
Hi Kiran,
Thanks for your reply. You are definitely not a beginner, and this project should add to your experience. If there is particular challenge in agriculture in your area (cold, heat, salt, dry conditions), then you might want to pick a native plant that does well in your particular climate and select that plant for your project.
Good luck. And let us know if you need any additional information.
Donna Hardy
Thanks for your reply. You are definitely not a beginner, and this project should add to your experience. If there is particular challenge in agriculture in your area (cold, heat, salt, dry conditions), then you might want to pick a native plant that does well in your particular climate and select that plant for your project.
Good luck. And let us know if you need any additional information.
Donna Hardy
-
KIRAN DEEPIKA
- Posts: 83
- Joined: Sun Jan 17, 2010 3:33 am
- Occupation: Student:12th grade
- Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
- Project Due Date: April 20, 2010
- Project Status: I am conducting my experiment
Re: CHLOROPLAST SEQUENCING
Thank you Donna Hardy for your support.. I will certainly come back everyday (hopefully) & share my views on how things went in the project..
Its really nice to have people like you here..
Thanks again..
Its really nice to have people like you here..
Thanks again..
-
KIRAN DEEPIKA
- Posts: 83
- Joined: Sun Jan 17, 2010 3:33 am
- Occupation: Student:12th grade
- Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
- Project Due Date: April 20, 2010
- Project Status: I am conducting my experiment
Re: CHLOROPLAST SEQUENCING
Hi.. I started my project today.. I had being to few plant nursaries to buy native plants with medicinal use. I found out centella asiatica (memory plant), leucas aspera (cough), leucas indica (cough), calotropis procera(fever) to be the most interesting, easily available & cheap at cost.. Can i proceed with my research with these plants..
And i have another doubt.. Can i use a different primer instead of the one given in sciencebuddies??? i.e.
PCR primers for amplifying rubisco large subunit
Two sets of primers are needed (total of 4 primers):
Primer mix #1
Forward primer 5' ATGTCACCACAAACAGAAAC 3'
Reverse primer 5' CTTCACAAGCAGCTAGTTC 3'
Primer mix #2
Forward primer 5' ATGTCACCACAAACAGAAAC 3'
Reverse primer 5' TCCTTTTAGTAAAAGATTGGGCCGAG 3'
Could you suggest me another Primer mix sequence that will amplify Rubisco enzyme??? Or atleast the method to determine another Primer mix sequence. I am good at PRIMER3 software. How should i go about in getting the specific Primer mix sequence through this software such that it will amplify Rubisco enzyme itself.. Hope i wont go wrong in what i do.. Or do you want me to use the same sequence as given in SceinceBuddies.. I want to publilsh the end result in GenBank.. So i want this to be novel in these aspects.. Hope any one could reply fast..
Thank you..
And i have another doubt.. Can i use a different primer instead of the one given in sciencebuddies??? i.e.
PCR primers for amplifying rubisco large subunit
Two sets of primers are needed (total of 4 primers):
Primer mix #1
Forward primer 5' ATGTCACCACAAACAGAAAC 3'
Reverse primer 5' CTTCACAAGCAGCTAGTTC 3'
Primer mix #2
Forward primer 5' ATGTCACCACAAACAGAAAC 3'
Reverse primer 5' TCCTTTTAGTAAAAGATTGGGCCGAG 3'
Could you suggest me another Primer mix sequence that will amplify Rubisco enzyme??? Or atleast the method to determine another Primer mix sequence. I am good at PRIMER3 software. How should i go about in getting the specific Primer mix sequence through this software such that it will amplify Rubisco enzyme itself.. Hope i wont go wrong in what i do.. Or do you want me to use the same sequence as given in SceinceBuddies.. I want to publilsh the end result in GenBank.. So i want this to be novel in these aspects.. Hope any one could reply fast..
Thank you..
-
donnahardy2
- Former Expert
- Posts: 2671
- Joined: Mon Nov 14, 2005 12:45 pm
Re: CHLOROPLAST SEQUENCING
Hi Kiran,
I'm so sorry I missed your reply last week and did send a reply earlier. Unfortunately, I'm not a molecular biologist so I can't answer the question about the primer. But I will try to find an answer for you or get someone else to help. Your plants sound like really interesting selections for this project.
Donna Hardy
I'm so sorry I missed your reply last week and did send a reply earlier. Unfortunately, I'm not a molecular biologist so I can't answer the question about the primer. But I will try to find an answer for you or get someone else to help. Your plants sound like really interesting selections for this project.
Donna Hardy
-
donnahardy2
- Former Expert
- Posts: 2671
- Joined: Mon Nov 14, 2005 12:45 pm
Re: CHLOROPLAST SEQUENCING
Hi Kiran,
From what I can tell, the priming sequences given on the science buddies project guide are the ones that will work, and I cannot tell if other primers will work.
Are you planning to clone the chloroplast gene and the rubisco complex as well?
Donna Hardy
From what I can tell, the priming sequences given on the science buddies project guide are the ones that will work, and I cannot tell if other primers will work.
Are you planning to clone the chloroplast gene and the rubisco complex as well?
Donna Hardy
-
KIRAN DEEPIKA
- Posts: 83
- Joined: Sun Jan 17, 2010 3:33 am
- Occupation: Student:12th grade
- Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
- Project Due Date: April 20, 2010
- Project Status: I am conducting my experiment
Re: CHLOROPLAST SEQUENCING
Thanks a million for taking time of your busy schedule & replying to your student
I was awaiting your reply. I am very happy to see your reply
For your question on Cloning Chloroplast & Rubisco complex.. The answer is,I am not doing it..
I have planned to use the same primer sequence which ScienceBuddies have given in their project...
Along with the four plants which i mentioned in the previous messages,i am also using another plant called Vetiveria zizanioides..
Can u please let me know whether all these five plants are sequenced or not???
Or atleast let me know which website & the method to know whether these plants are sequenced are not..
I want this project to be novel. So my efforts to do the background survey.
Thanks Donna Hardy mam for taking time to read my queries...
Yours sincerely,
Kiran Deepika.
I was awaiting your reply. I am very happy to see your reply
For your question on Cloning Chloroplast & Rubisco complex.. The answer is,I am not doing it..
I have planned to use the same primer sequence which ScienceBuddies have given in their project...
Along with the four plants which i mentioned in the previous messages,i am also using another plant called Vetiveria zizanioides..
Can u please let me know whether all these five plants are sequenced or not???
Or atleast let me know which website & the method to know whether these plants are sequenced are not..
I want this project to be novel. So my efforts to do the background survey.
Thanks Donna Hardy mam for taking time to read my queries...
Yours sincerely,
Kiran Deepika.
-
KIRAN DEEPIKA
- Posts: 83
- Joined: Sun Jan 17, 2010 3:33 am
- Occupation: Student:12th grade
- Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
- Project Due Date: April 20, 2010
- Project Status: I am conducting my experiment
Re: CHLOROPLAST SEQUENCING
I am suggested by my teachers to use liquid nitrogen & cTAB reagent for isolation of chloroplast genome & then purify & store it..
This is done instead of the DISC DISPLACEMENT METHOD using the pipette tip or the tooth pick which is explained in the ScienceBuddies project..
Can you tell me which gives better results.. Our teachers say the Disc Displacement method is mostly used for Callus Culture.. So i am confused
Can you please give me the procedure for the purification & storage of the isolated Chloroplast genome..
I will be waiting for your reply..
Thanks for your time in reading this ....
This is done instead of the DISC DISPLACEMENT METHOD using the pipette tip or the tooth pick which is explained in the ScienceBuddies project..
Can you tell me which gives better results.. Our teachers say the Disc Displacement method is mostly used for Callus Culture.. So i am confused
Can you please give me the procedure for the purification & storage of the isolated Chloroplast genome..
I will be waiting for your reply..
Thanks for your time in reading this ....
-
donnahardy2
- Former Expert
- Posts: 2671
- Joined: Mon Nov 14, 2005 12:45 pm
Re: CHLOROPLAST SEQUENCING
Hi Kiran,
Your teachers are correct. The liquid nitrogen & cTAB reagent is most commonly used for isolating plant genes, so you should use this technique if it is available for you. It will do a better job of extracting the DNA from the plant cells. The protocols on the science buddies website are simplified and we try to avoid suggesting items like liquid nitrogen that would not normally be available in a high school laboratory.
Here is some additional information that might help in cloning the rubisco gene. You can search for the sequence on the following website:
http://www.ncbi.nlm.nih.gov/nuccore?term=rubisco
And, you can use that information to get suggestions for a primer sequence on the following website:
http://frodo.wi.mit.edu/primer3/
Donna Hardy
Your teachers are correct. The liquid nitrogen & cTAB reagent is most commonly used for isolating plant genes, so you should use this technique if it is available for you. It will do a better job of extracting the DNA from the plant cells. The protocols on the science buddies website are simplified and we try to avoid suggesting items like liquid nitrogen that would not normally be available in a high school laboratory.
Here is some additional information that might help in cloning the rubisco gene. You can search for the sequence on the following website:
http://www.ncbi.nlm.nih.gov/nuccore?term=rubisco
And, you can use that information to get suggestions for a primer sequence on the following website:
http://frodo.wi.mit.edu/primer3/
Donna Hardy
-
donnahardy2
- Former Expert
- Posts: 2671
- Joined: Mon Nov 14, 2005 12:45 pm
Re: CHLOROPLAST SEQUENCING
Hi Kiran,
I forgot to answer your second question. The plant sample that you treat with liquid nitrogen and cTAB is the DNA and no further sample preparation is needed. If you are not going to do the PCR right away, then you should store the sample in the freezer at minus 20 degrees Centigrade.
Donna Hardy
I forgot to answer your second question. The plant sample that you treat with liquid nitrogen and cTAB is the DNA and no further sample preparation is needed. If you are not going to do the PCR right away, then you should store the sample in the freezer at minus 20 degrees Centigrade.
Donna Hardy
-
KIRAN DEEPIKA
- Posts: 83
- Joined: Sun Jan 17, 2010 3:33 am
- Occupation: Student:12th grade
- Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
- Project Due Date: April 20, 2010
- Project Status: I am conducting my experiment
Re: CHLOROPLAST SEQUENCING
Thanks a million tons Donna Hardy mam
These are the very information i wanted all these days.. I am really very happy to get them..
Now i know where i am heading in my research..
I will get back to you if there are more doubts..
SCIENCE BUDDIES ROCKS!!!!
Your sincere student,
Kiran Deepika
These are the very information i wanted all these days.. I am really very happy to get them..
Now i know where i am heading in my research..
I will get back to you if there are more doubts..
SCIENCE BUDDIES ROCKS!!!!
Your sincere student,
Kiran Deepika
-
KIRAN DEEPIKA
- Posts: 83
- Joined: Sun Jan 17, 2010 3:33 am
- Occupation: Student:12th grade
- Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
- Project Due Date: April 20, 2010
- Project Status: I am conducting my experiment
Re: CHLOROPLAST SEQUENCING
Hi, my teachers are asking me why the rubisco gene is specifically used for determining medicinal properties in plants & how is this gene responsible for relating two plants on evolutionary basis..??
Can you please tell me what was interpreted from this ScienceBuddies project..???
And how is rubisco gene related to medicinal properties of plants..???
After determining that two plants are related on evolutionary basis, can we imply that they have the same medicinal properties..???
Please reply as soon as possible as i am supposed to report all these details by tommorrow to my teachers..
Can you please tell me what was interpreted from this ScienceBuddies project..???
And how is rubisco gene related to medicinal properties of plants..???
After determining that two plants are related on evolutionary basis, can we imply that they have the same medicinal properties..???
Please reply as soon as possible as i am supposed to report all these details by tommorrow to my teachers..
-
donnahardy2
- Former Expert
- Posts: 2671
- Joined: Mon Nov 14, 2005 12:45 pm
Re: CHLOROPLAST SEQUENCING
Hi Kiran,
The nucleotide sequence of RuBisCo is being used to determine the evolutionary relationship of plants. Here is an example of a reference that uses this technique:
http://aem.asm.org/cgi/reprint/70/6/3443.pdf
The principle of grouping plants according the is called cladistics and this is explained in the following website:
http://en.wikipedia.org/wiki/Cladistics
I could not find any references that show that the RubBisCo determines the medicinal properties of plants. But it could help show the relationship of a medicinal plant to other plants.
With your project, you will be cloning the RuBisCo gene of plants that have known medicinal properties.
I hope this helps!
Donna Hardy
The nucleotide sequence of RuBisCo is being used to determine the evolutionary relationship of plants. Here is an example of a reference that uses this technique:
http://aem.asm.org/cgi/reprint/70/6/3443.pdf
The principle of grouping plants according the is called cladistics and this is explained in the following website:
http://en.wikipedia.org/wiki/Cladistics
I could not find any references that show that the RubBisCo determines the medicinal properties of plants. But it could help show the relationship of a medicinal plant to other plants.
With your project, you will be cloning the RuBisCo gene of plants that have known medicinal properties.
I hope this helps!
Donna Hardy
-
KIRAN DEEPIKA
- Posts: 83
- Joined: Sun Jan 17, 2010 3:33 am
- Occupation: Student:12th grade
- Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
- Project Due Date: April 20, 2010
- Project Status: I am conducting my experiment
Re: CHLOROPLAST SEQUENCING
Thanks Donna mam...
But my objective of the project is FINDING OUT EVOLUTIONARILY RELATED MEDICINAL PLANTS by sequencing common medicinal plants...
Can this be done by Chloroplast sequencing???
By finding out two plants to be evolutionarily related, can we imply they have the same medicinal properties???
My idea is to use one medicinal plant instead of the other..
Hope this is feasable using this project..
If not, how can i modify my objective to make it still have application orientation in my project using medicinal plants..??
Please help.. I guess my idea is not in the right direction now...
But my objective of the project is FINDING OUT EVOLUTIONARILY RELATED MEDICINAL PLANTS by sequencing common medicinal plants...
Can this be done by Chloroplast sequencing???
By finding out two plants to be evolutionarily related, can we imply they have the same medicinal properties???
My idea is to use one medicinal plant instead of the other..
Hope this is feasable using this project..
If not, how can i modify my objective to make it still have application orientation in my project using medicinal plants..??
Please help.. I guess my idea is not in the right direction now...
-
donnahardy2
- Former Expert
- Posts: 2671
- Joined: Mon Nov 14, 2005 12:45 pm
Re: CHLOROPLAST SEQUENCING
Hi Kiran,
That for your additional questions that helped explain your concern about this project. Your project is an excellent one and I don't think you should change it, but in determining the chloroplast nucleotide sequence, you will be investigating the evolutionary relationship between two plants. With the chloroplast project, you will simply be able to see the difference between the nucleotide sequences of two plants. This information would imply that there might be similar medicinal molecules in plants that are closely related, but any conclusions about the medicinal properties would be outside the scope of your project.
Maybe it would be better to restate your objective because you don’t want to appear to be claiming that determining the sequence for the rubisco sequence will necessarily mean that a plant has certain medicinal qualities. Why don’t you state that the chloroplast sequence will help determine the evolutionary relationship between two plants? In your discussion section of the report, you can say that if two organisms are shown to be closely related and one contains a medicinal compound, then it would be worthwhile to look at a closely related plant to find a similar compound.
You are going to be testing 3 plants, 2 with medicinal properties for cough and 1 for fever. Have you been able to find any details about the chemical composition of the therapeutic compounds found in these plants? That information would be very helpful to add to your background research.
I hope this helps. Please let me know if you have any additional concerns.
Donna Hardy
That for your additional questions that helped explain your concern about this project. Your project is an excellent one and I don't think you should change it, but in determining the chloroplast nucleotide sequence, you will be investigating the evolutionary relationship between two plants. With the chloroplast project, you will simply be able to see the difference between the nucleotide sequences of two plants. This information would imply that there might be similar medicinal molecules in plants that are closely related, but any conclusions about the medicinal properties would be outside the scope of your project.
Maybe it would be better to restate your objective because you don’t want to appear to be claiming that determining the sequence for the rubisco sequence will necessarily mean that a plant has certain medicinal qualities. Why don’t you state that the chloroplast sequence will help determine the evolutionary relationship between two plants? In your discussion section of the report, you can say that if two organisms are shown to be closely related and one contains a medicinal compound, then it would be worthwhile to look at a closely related plant to find a similar compound.
You are going to be testing 3 plants, 2 with medicinal properties for cough and 1 for fever. Have you been able to find any details about the chemical composition of the therapeutic compounds found in these plants? That information would be very helpful to add to your background research.
I hope this helps. Please let me know if you have any additional concerns.
Donna Hardy
-
KIRAN DEEPIKA
- Posts: 83
- Joined: Sun Jan 17, 2010 3:33 am
- Occupation: Student:12th grade
- Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
- Project Due Date: April 20, 2010
- Project Status: I am conducting my experiment
Re: CHLOROPLAST SEQUENCING
Thank you Donna mam... This info was of great help to me..
It really comforted me when i was in total confusion..
Today, i will talk to my teachers & let you know in 12 hours what they said..
Thank you for sparing time of your busy schedule & replying to all the students here...
I thank you from the bottom of my heart for your efforts in making our projects easy & helping us get red of our project confusions
Have great day, mam
It really comforted me when i was in total confusion..
Today, i will talk to my teachers & let you know in 12 hours what they said..
Thank you for sparing time of your busy schedule & replying to all the students here...
I thank you from the bottom of my heart for your efforts in making our projects easy & helping us get red of our project confusions
Have great day, mam
-
KIRAN DEEPIKA
- Posts: 83
- Joined: Sun Jan 17, 2010 3:33 am
- Occupation: Student:12th grade
- Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
- Project Due Date: April 20, 2010
- Project Status: I am conducting my experiment
Re: CHLOROPLAST SEQUENCING
I spoke to my teachers today. They were happy with the reason that i gave regarding the Objective and your reply.
I told them about your help through ScienceBuddies as well. I am honoured to get so much support from you mam.
After finishing with the EVOLUTIONARY CHARACTERIZATION using chloroplast sequencing, I want to further continue my research by FINDING OUT ALTERNATIVE MEDICINAL PLANTS having same medicinal properties as stated in my objective i.e.
In this project, chloroplast sequencing is used to determine the evolutionary relationship between two plants. This can help focus further research on specific medicinal properties between similar plants. By applying this technology to rare plants, we can find commonly available plants with similar medicinal properties & by further extraction - comparison of similar secondary metabolites, we can limit the use of endangered plants.
This will involve SECONDARY METABOLITE EXTRACTION (medicinal compound - as you termed it in the previous reply).
So i will start with my literature survey on SECONDARY METABOLITE EXTRACTION of my plants. If you have any papers related to this context please do help me,mam..
Hope you like my project title - Economic exploitation & Preservation of Endangered Medicinal plants by using Alternative plants by Rubisco Gene Sequencing & Secondary metabolite extraction...
With your support & my teachers help, I can finish with the most ambitious project of my student life..
If you have any advice or suggestions, please do let me know...
Even criticism accepted...
Yours Sincerely,
KIRAN DEEPIKA
I told them about your help through ScienceBuddies as well. I am honoured to get so much support from you mam.
After finishing with the EVOLUTIONARY CHARACTERIZATION using chloroplast sequencing, I want to further continue my research by FINDING OUT ALTERNATIVE MEDICINAL PLANTS having same medicinal properties as stated in my objective i.e.
In this project, chloroplast sequencing is used to determine the evolutionary relationship between two plants. This can help focus further research on specific medicinal properties between similar plants. By applying this technology to rare plants, we can find commonly available plants with similar medicinal properties & by further extraction - comparison of similar secondary metabolites, we can limit the use of endangered plants.
This will involve SECONDARY METABOLITE EXTRACTION (medicinal compound - as you termed it in the previous reply).
So i will start with my literature survey on SECONDARY METABOLITE EXTRACTION of my plants. If you have any papers related to this context please do help me,mam..
Hope you like my project title - Economic exploitation & Preservation of Endangered Medicinal plants by using Alternative plants by Rubisco Gene Sequencing & Secondary metabolite extraction...
With your support & my teachers help, I can finish with the most ambitious project of my student life..
If you have any advice or suggestions, please do let me know...
Even criticism accepted...
Yours Sincerely,
KIRAN DEEPIKA
-
donnahardy2
- Former Expert
- Posts: 2671
- Joined: Mon Nov 14, 2005 12:45 pm
Re: CHLOROPLAST SEQUENCING
Hi Kiran,
Thanks for your reply. I'm very happy you have finalized the objective for this project. It's good that you are considering what your future experiments might be. My only concern is that this is a very ambitious project that could potentially take a long time to complete. You could consider continuing this project in college and beyond. It is an extremely fascinating and worthwhile field of study.
Donna Hardy
Thanks for your reply. I'm very happy you have finalized the objective for this project. It's good that you are considering what your future experiments might be. My only concern is that this is a very ambitious project that could potentially take a long time to complete. You could consider continuing this project in college and beyond. It is an extremely fascinating and worthwhile field of study.
Donna Hardy
-
KIRAN DEEPIKA
- Posts: 83
- Joined: Sun Jan 17, 2010 3:33 am
- Occupation: Student:12th grade
- Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
- Project Due Date: April 20, 2010
- Project Status: I am conducting my experiment
Re: CHLOROPLAST SEQUENCING
Thank you Donna mam for your reply..
I came back from school just now. Thanks for reading my messages daily & replying sooner than i expect..
I was looking through google in school to find the secondary metabolites for my plants (Leucas aspera & Centella asiatica)
But there were many things which i could not understand or they dint answer my question in the papers that i read..
My doubt is ARE MY PLANT'S SECONDARY METABOLITES PRESENT IN SOME OTHER MEDICINAL PLANTS ALSO??? This is necessaery as my objectives demands this aspect.
Atleast i want the link where i could find out plants having similar secondary metabolites.. It is real fun obtaining knowledge through efforts online
I want the literature survey to be fully done with complete protocol before i proceed further..
Hope i am not troubling you people with all my doubts
Thanks for reading this... I will be awaiting reply...
I came back from school just now. Thanks for reading my messages daily & replying sooner than i expect..
I was looking through google in school to find the secondary metabolites for my plants (Leucas aspera & Centella asiatica)
But there were many things which i could not understand or they dint answer my question in the papers that i read..
My doubt is ARE MY PLANT'S SECONDARY METABOLITES PRESENT IN SOME OTHER MEDICINAL PLANTS ALSO??? This is necessaery as my objectives demands this aspect.
Atleast i want the link where i could find out plants having similar secondary metabolites.. It is real fun obtaining knowledge through efforts online
I want the literature survey to be fully done with complete protocol before i proceed further..
Hope i am not troubling you people with all my doubts
Thanks for reading this... I will be awaiting reply...
-
MelissaB
- Moderator
- Posts: 1055
- Joined: Mon Oct 16, 2006 11:47 am
Re: CHLOROPLAST SEQUENCING
Hi Kiran,
If I'm reading your post correctly, you found some of the secondary metabolites that your study plants produced, right? Once you have that, you can do a literature search on that compound and see if people have found it in other plants.
Keep in mind, though, that many plants have just not been studied before, so that metabolite may exist in other plants but may not actually have been found before--there are thousands of species of plants, and not every one has been put through a mass spectrometer, etc.
If I'm reading your post correctly, you found some of the secondary metabolites that your study plants produced, right? Once you have that, you can do a literature search on that compound and see if people have found it in other plants.
Keep in mind, though, that many plants have just not been studied before, so that metabolite may exist in other plants but may not actually have been found before--there are thousands of species of plants, and not every one has been put through a mass spectrometer, etc.
-
donnahardy2
- Former Expert
- Posts: 2671
- Joined: Mon Nov 14, 2005 12:45 pm
Re: CHLOROPLAST SEQUENCING
Hi Kiran,
Here is a website that lists volatile oils in Leucas aspera.
http://findarticles.com/p/articles/mi_q ... n16028104/
“Among the 25 compounds identified from the leaf volatiles, α-farnesene (26.4%), α-thujene (12.6%) and menthol (11.3%) were the major constituents and among the 10 compounds identified from the flower volatiles, amyl propionate (15.2%) and isoamyl propionate (14.4%) were dominant.”
Here’s more information on the composition of this plant, showing the presence of nicotine and many other compounds.
http://www.ijpsonline.com/article.asp?i ... ngathayaru
This is going to be a very complex project. Is there just one compound that you would like to focus on?
I think it would be helpful if you limited the scope of your project rather than trying to include the evolutionary relationship of the plants and the complete chemical composition of all of the metabolites. Doing just the chloroplast cloning part of the project will be a challenging project and will help understand the evolutionary relationship of the plants. That is plenty to do in one project.
However, if you do want to include the secondary metabolites, it would be helpful to focus on just one molecule of interest.
Donna Hardy
Here is a website that lists volatile oils in Leucas aspera.
http://findarticles.com/p/articles/mi_q ... n16028104/
“Among the 25 compounds identified from the leaf volatiles, α-farnesene (26.4%), α-thujene (12.6%) and menthol (11.3%) were the major constituents and among the 10 compounds identified from the flower volatiles, amyl propionate (15.2%) and isoamyl propionate (14.4%) were dominant.”
Here’s more information on the composition of this plant, showing the presence of nicotine and many other compounds.
http://www.ijpsonline.com/article.asp?i ... ngathayaru
This is going to be a very complex project. Is there just one compound that you would like to focus on?
I think it would be helpful if you limited the scope of your project rather than trying to include the evolutionary relationship of the plants and the complete chemical composition of all of the metabolites. Doing just the chloroplast cloning part of the project will be a challenging project and will help understand the evolutionary relationship of the plants. That is plenty to do in one project.
However, if you do want to include the secondary metabolites, it would be helpful to focus on just one molecule of interest.
Donna Hardy
-
KIRAN DEEPIKA
- Posts: 83
- Joined: Sun Jan 17, 2010 3:33 am
- Occupation: Student:12th grade
- Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
- Project Due Date: April 20, 2010
- Project Status: I am conducting my experiment
Re: CHLOROPLAST SEQUENCING
FOR DONNA MAM..
Thank you for spending your time in finding out the details i wanted.
It was of great help to me 
I am focussing my objective mainly on CHLOROPLAST SEQUENCING. But if time permits i would like to move on to the SECONDARY METABOLITES aspect too.
I will certainly consider your suggestion of working on only one secondary metabolite (which even i had thought about).
Thank you Donna mam for your support daily.
I will get back to SCIENCEBUDDIES for sure when in doubt..
Thank you for spending your time in finding out the details i wanted.
I am focussing my objective mainly on CHLOROPLAST SEQUENCING. But if time permits i would like to move on to the SECONDARY METABOLITES aspect too.
I will certainly consider your suggestion of working on only one secondary metabolite (which even i had thought about).
Thank you Donna mam for your support daily.
I will get back to SCIENCEBUDDIES for sure when in doubt..
-
KIRAN DEEPIKA
- Posts: 83
- Joined: Sun Jan 17, 2010 3:33 am
- Occupation: Student:12th grade
- Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
- Project Due Date: April 20, 2010
- Project Status: I am conducting my experiment
Re: CHLOROPLAST SEQUENCING
Thank you, MelissaB mam for your reply as well..
I will apply your approach to find out & compare secondary metabolites of similar medicinal plants..
I will work on these aspects & get back with my progress & doubts daily..
Thanks tons for your views mam...
ScienceBuddies truly is the best for budding Scientists

I will apply your approach to find out & compare secondary metabolites of similar medicinal plants..
I will work on these aspects & get back with my progress & doubts daily..
Thanks tons for your views mam...
ScienceBuddies truly is the best for budding Scientists

