CHLOROPLAST SEQUENCING

Ask questions about projects relating to: biology, biochemistry, genomics, microbiology, molecular biology, pharmacology/toxicology, zoology, human behavior, archeology, anthropology, political science, sociology, geology, environmental science, oceanography, seismology, weather, or atmosphere.

Moderators: AmyCowen, kgudger, MadelineB, Moderators

KIRAN DEEPIKA
Posts: 83
Joined: Sun Jan 17, 2010 3:33 am
Occupation: Student:12th grade
Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
Project Due Date: April 20, 2010
Project Status: I am conducting my experiment

Re: CHLOROPLAST SEQUENCING

Post by KIRAN DEEPIKA »

Hi.. :mrgreen:
I am currently doing my project.. :P
Sorry for not reporting my progress as promised.. :cry:
Days have being hectic with the project :(

I found out an alternative protocol for isolation of genome from leaves without the use of liquid nitrogen..
Please let me know whether its feasible or not..
1. Gather healthy green leaves from two medicinal plants.
2. Give each plant a unique identification code.
3. For each sample, pipette 200 μl of sterile double-distilled water (ddH2O) into a PCR tube.
4. Grind 200 mg of plant tissue to a fine paste in approximately 500 μl of CTAB buffer.
5. Transfer CTAB/plant extract mixture to a microfuge tube.
6. Incubate the CTAB/plant extract mixture for about 15 min at 55o C in a recirculating
water bath.
7. fter incubation, spin the CTAB/plant extract mixture at 12000 g for 5 min to spin
down cell debris. Transfer the supernatant to clean microfuge tubes.
8. To each tube add 250 μl of Chloroform : Iso Amyl Alcohol (24:1) and mix the
solution by inversion. After mixing, spin the tubes at 13000 rpm for 1 min.
9. Transfer the upper aqueous phase only (contains the DNA) to a clean microfuge
tube.
10. To each tube add 50 μl of 7.5 M Ammonium Acetate followed by 500 μl of ice cold
absolute ethanol.
11. Invert the tubes slowly several times to precipitate the DNA. Generally the DNA can
be seen to precipitate out of solution. Alternatively the tubes can be placed for 1 hr at
-20 o C after the addition of ethanol to precipitate the DNA.
12. Following precipitation, the DNA can be pipetted off by slowly rotating/spinning a
tip in the cold solution. The precipitated DNA sticks to the pipette and is visible as a
clear thick precipitate. To wash the DNA, transfer the precipitate into a microfuge
tube containing 500 μl of ice cold 70 % ethanol and slowly invert the tube. Repeat.
((alternatively the precipitate can be isolated by spinning the tube at 13000 rpm for a
minute to form a pellet. Remove the supernatant and wash the DNA pellet by adding
two changes of ice cold 70 % ethanol )).
After the wash, spin the DNA into a pellet by centrifuging at 13000 rpm for 1 min.
Remove all the supernatant and allow the DNA pellet to dry (approximately 15 min).
Do not allow the DNA to over dry or it will be hard to re-dissolve.
13. Resuspend the DNA in sterile DNase free water (approximately 50-400 μl H2O; the
amount of water needed to dissolve the DNA can vary, depending on how much is
isolated). RNaseA (10 μg/ml) can be added to the water prior to dissolving the DNA
to remove any RNA in the preparation (10 μl RNaseA in 10ml H2O).
14. After resuspension, the DNA is incubated at 65o C for 20 min to destroy any DNases
that may be present and store at 4o C.
15. Repeat steps for the other two plant leaves. Store the tubes of plant DNA in the refrigerator until we are ready to proceed to the PCR steps.


MY PROGRESS :
At present i have brought my plants home..
Gathered all chemicals (except liquid nitrogen) & glassware in school for my use..
Contacted a company for DNA sequencing & got their application form with school's help..
Practiced Bioinformatics tools for their use by doing the project What is the Woolly Mammoth's Closest Living Relative & Use DNA Sequencing to Trace the Blue Whale's Evolutionary Tree given in PROJECT IDEAS of SCIENCEBUDDIES to get a hang of bioinformatics..
We are working only on mondays,tuesdays & wednesdays every week..
I am just keeping everything ready such that i do things systematically at a stretch when i start..
Thats why all the advance preparations.. :)

Read few papers on Secondary Metabolite extraction..
My teachers suggested me to do this part of the project after I finish Schooling..

Donna mam or anyone reading this, if you have any advice, please lead me the way..
& help me with the above doubt..


Thank you for your time in reading this... 8)
KIRAN DEEPIKA
Posts: 83
Joined: Sun Jan 17, 2010 3:33 am
Occupation: Student:12th grade
Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
Project Due Date: April 20, 2010
Project Status: I am conducting my experiment

Re: CHLOROPLAST SEQUENCING

Post by KIRAN DEEPIKA »

Please reply.. :oops:
I have been waiting for an answer from the past 3days :(

I found out an alternative protocol (as typed above) for isolation of genome from leaves without the use of liquid nitrogen..
Please let me know whether its feasible or not..


I just need an answer in the form of YES or NO..

Just want a conformation from ScienceBuddies.. Till then i will be very skeptical to go on with my project..
Please help.. :cry:

Thank you for your time in reading even this...
donnahardy2
Former Expert
Posts: 2671
Joined: Mon Nov 14, 2005 12:45 pm

Re: CHLOROPLAST SEQUENCING

Post by donnahardy2 »

Hi Kiran,

I apologize for the delay in responding. I have looked at the protocol and had one of our company's molecular biologists review it and it does appear to be a good protocol, so I would recommend that you go ahead and use it. The dry ice is very effective in breaking down the cell wall, so the success of this protocol probably depends on having a good grinding technique. Where did you find this protocol?

Donna Hardy
KIRAN DEEPIKA
Posts: 83
Joined: Sun Jan 17, 2010 3:33 am
Occupation: Student:12th grade
Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
Project Due Date: April 20, 2010
Project Status: I am conducting my experiment

Re: CHLOROPLAST SEQUENCING

Post by KIRAN DEEPIKA »

Please dont apologize to your student mam..!! :shock:
I was ready to wait for your reply even for another few days..
Thanks for our approval Donna mam :D
Thanks for your efforts in making Molecular Biologists review it..
I am very honoured.. :P

My teachers told me that Liquid nitrogen must be bought from an institution called Indian Institute Of Science, Bangalore..
I never wanted to travel half a day to get Liquid Nitrogen using our principal's letter..
So i put some efforts to find an alternative..
8)
Then i found the isolation part (wich i have typed above) from a pdf file in google & I edited it according to my project & pasted it in the above post..

Please type this in google - Plant Genomic DNA Extraction by CTAB _2__Fiona.. you will get the file that you are looking for..

You are the Best,mam..
Hope you are happy with my work.. :P
donnahardy2
Former Expert
Posts: 2671
Joined: Mon Nov 14, 2005 12:45 pm

Re: CHLOROPLAST SEQUENCING

Post by donnahardy2 »

Hi Kiran,

Thanks for the reference. You are doing an excellent job on your project! Let me know if you have any other questions.


Donna Hardy
KIRAN DEEPIKA
Posts: 83
Joined: Sun Jan 17, 2010 3:33 am
Occupation: Student:12th grade
Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
Project Due Date: April 20, 2010
Project Status: I am conducting my experiment

Re: CHLOROPLAST SEQUENCING

Post by KIRAN DEEPIKA »

I will certainly come back here when in doubt.. 8)
Thank you mam.. :D :) :P
KIRAN DEEPIKA
Posts: 83
Joined: Sun Jan 17, 2010 3:33 am
Occupation: Student:12th grade
Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
Project Due Date: April 20, 2010
Project Status: I am conducting my experiment

Re: CHLOROPLAST SEQUENCING

Post by KIRAN DEEPIKA »

Hi..
Sorry for no posts in the recent days.. :roll:

I was busy preparing for the trial presentation in school to acquire funding for my project..
Today i presented my project concept to six professors.. All were impressed with the project & gave me the thumbs up for funding as well..
So 90% of the expences will be looked after by my school itself.. 8)
And after i complete my Schooling, this project will be carried on by my juniors by appling on different medicinal plants..
I am very happy with this project.. :P

But i could not answer 1 question which was posed by a professor.. :(
And that is - WHY IS ONLY THIS PARTICULAR PRIMER SEQUENCE IS CHOSEN FOR ALL PLANT'S RUBISCO GENOME SEQUENCING..???

I told them that ONLY THIS SEQUENCE AMPLIFIES THE RUBUSCO PORTION OF THE CHLOROPLAST GENOME & NOT OTHERS..
I showed them the proof as well through PRIMER3 software which gave a different sequence for rubisco..
But i couldnot give them a more convincing answer..

They suggested me to find out a better reason, why only that particular primer sequence (as given in the previous posts & in SCIENCEBUDDIES PROJECT IDEAS) & not the others obtained from PRIMER3 software were used..!!!

Overall i am very happy with the way today turned out to be..
I owe my today's success to Donna mam & SCIENCEBUDDIES.. :D

Hope you would clear this doubt of mine as well..
Thank you a million tons.. :mrgreen:
donnahardy2
Former Expert
Posts: 2671
Joined: Mon Nov 14, 2005 12:45 pm

Re: CHLOROPLAST SEQUENCING

Post by donnahardy2 »

Hi Kiran,

Congratulations on the successful presentation of your project! I’m very happy that you have obtained the funding to continue as this is a very worthwhile project.

Your professors do have a good question; however, I do not know what the particular primer sequence was chosen for this project. I think that any of the sequences given in primer 3 would work, but for a long term collaborative project, it will be easier to compare results if everyone uses the same primer sequence. I will see if I can get more information on this topic for you.

Donna Hardy
KIRAN DEEPIKA
Posts: 83
Joined: Sun Jan 17, 2010 3:33 am
Occupation: Student:12th grade
Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
Project Due Date: April 20, 2010
Project Status: I am conducting my experiment

Re: CHLOROPLAST SEQUENCING

Post by KIRAN DEEPIKA »

Thanks a lot for the compliments, Donna mam.. :)
I will be definately waiting for your answers..

I am loving the way my project is shaping up.. :D
Wish i had found SCIENCEBUDDIES 3years ago.. Then my ideas & your help would have helped me win more awards..

Thanks again for your support.. :wink:
KIRAN DEEPIKA
Posts: 83
Joined: Sun Jan 17, 2010 3:33 am
Occupation: Student:12th grade
Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
Project Due Date: April 20, 2010
Project Status: I am conducting my experiment

Re: CHLOROPLAST SEQUENCING

Post by KIRAN DEEPIKA »

Please reply anyone.. :?
WHY IS ONLY THIS PARTICULAR PRIMER SEQUENCE CHOSEN FOR ALL PLANT'S RUBISCO GENOME SEQUENCING..???
When i tried to obtain primers through PRIMER3 software, i was getting different Primer sequence for different plants.. Can you explain why please???

I tried different websites (like SCITOYS) and asked them their reply as well.. 8)
But it dint work.. :(
These doubts when not cleared make me stagnant in my work..
Wish i know the true reason for the use of this primer sequence atleast by tomorrow..

Two sets of primers are needed (total of 4 primers):
1. Primer mix #1
Forward primer 5' ATGTCACCACAAACAGAAAC 3'
Reverse primer 5' CTTCACAAGCAGCTAGTTC 3'
2. Primer mix #2
Forward primer 5' ATGTCACCACAAACAGAAAC 3'
Reverse primer 5' TCCTTTTAGTAAAAGATTGGGCCGAG 3'


Hoping i am not demanding too much from the experts here.. :shock:
Sorry!!! :oops:
donnahardy2
Former Expert
Posts: 2671
Joined: Mon Nov 14, 2005 12:45 pm

Re: CHLOROPLAST SEQUENCING

Post by donnahardy2 »

Hi Kiran,

The primer sequences given were apparently optimized to clone highly conserved sequences of the DNA that would allow comparing the evolutionary relationship between plants. It's possible that other sequences would work to clone Rubisco, but for the evolutionary study, in order to provide consistency, it would be better to use the given sequences for the project. It would not be possible to compare your results with others participating in this project if you chose a different primer sequence.

Having the reoptimize the sequences to use for a project like this would require a lot of work, and would be beyond the scope of a science project. Your project is very challenging without having to start at the very beginning.

Donna Hardy
KIRAN DEEPIKA
Posts: 83
Joined: Sun Jan 17, 2010 3:33 am
Occupation: Student:12th grade
Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
Project Due Date: April 20, 2010
Project Status: I am conducting my experiment

Re: CHLOROPLAST SEQUENCING

Post by KIRAN DEEPIKA »

Hi..
Thank you Donna mam for the reply.. :D
I will definately use the reason that you gave for my question on primers during my presentation.. :P

I have another doubt.. :?
Can you tell me how that particular primer sequence was obtained.??? By which method,the primer sequence was obtained.??? :(
These are definate questions that will be asked. So i want to be clear now itself.. :oops:
MY PROGRESS IN PROJECT:
Now i am done placing order for my Primer sequence from a company.
I am done with isolation of the Chloroplast genome. Next week we will start with PCR amplification & Electrophoresis.. :D
So these 3 days i will be studying Why only those particular chemical reagents (as given in SCIENCE BUDDIES) are chosen & not others..
If you have any links related to this, please do help me in this as well..
Sorry for burdening you with so many questions daily..
Infact i am feeling wierd to ask so many doubts..
:roll:

Thank you anyways for your Infinite help,Donna mam..
You are the best!!!!
carolinethorn
Former Expert
Posts: 393
Joined: Tue Sep 20, 2005 2:40 pm

Re: CHLOROPLAST SEQUENCING

Post by carolinethorn »

This is a great project and you seem to be doing very well. I hope I have understood your question - you want to know how the person who designed the primers chose those? I do not know the answer for a fact but I would guess they designed them to bind in a region that is very conserved in many plants where the sequence is almost identical. What they probably did was looked at the sequences for RUBISCO available in Genbank and aligned them to see which parts of the sequence were most identical, and chose a primer in that region. That way a primer would bind to all of those sequences and also probably most plants that haven't been sequenced yet.

I thought of another reason why choosing the particular primers specified in the Science Buddies protocol would be a good idea - someone has tested these primers and seen that they work at the temperature specified in the PCR reaction protocol. Even though when you design primers you can predict what temperature they should work at, sometimes in real life it takes a little optimising to get the PCR to work.

The reason for using the chemical reagents in the science buddies protocol is similar to why to use the same primers - empirical evidence - ie. someone has tested them and it worked. The basic reagents for PCR are always the same - DNA, primers, buffer, Magnesium, dNTPs and Taq polymerase. The Taq polymerase is the enzyme that carries out the PCR reaction and makes copies of the piece of DNA you are interested in. It needs the other reagents to work - the dNTPs are the DNA bases in a form that the polymerase can string together to make the copy of DNA. It needs the primers to begin the process and adds the dNTPs to them to extend the copied DNA. The buffer is a way to ensure the pH and ion content is just right for the Taq enzyme to work. And the Taq needs magnesium to be able to catalyze the reaction. If you look at the protocol in the Bibliography section there were a couple of links about PCR that also talk about how it works and what is used in the reaction.

Hope this helps,

Caroline
KIRAN DEEPIKA
Posts: 83
Joined: Sun Jan 17, 2010 3:33 am
Occupation: Student:12th grade
Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
Project Due Date: April 20, 2010
Project Status: I am conducting my experiment

Re: CHLOROPLAST SEQUENCING

Post by KIRAN DEEPIKA »

Thank you Caroline mam... :D
This info was of great help to me.. 8)

It cleared all my primer doubts.. Now i am confident of answering such questions.. 8)
Thank you for replying for the Chemical Reagents as well..
I knew the the functions of some chemicals after finding out through google.. But i am more happy to find every question answered & every doubt cleared here..
ScienceBuddies is awesome.. :P

Thanks again Caroline mam.. :)
Thank you for liking my project as well.. :o

I will come back again when i am in doubt or stuck up some where... :D
aelin
Former Expert
Posts: 78
Joined: Sun Sep 27, 2009 6:50 pm
Occupation: Student: Junior in College
Project Question: Role of viral proteins in the HSV1 life cycle, specifically during entry and egress.
Project Due Date: n/a
Project Status: Not applicable

Re: CHLOROPLAST SEQUENCING

Post by aelin »

Hi Kiran,

Again, quite an excellent project; I'm glad that you got the funding. I just have a small additional FYI bit with respect to primer synthesis. When researchers use software to design primers, they tend to pick primers that are also unique regions within the genomic DNA. By this I mean that they try to ensure that the sequence that the primer binds to on the DNA is unique to that region, or else PCR would be amplifying not only your region of interest, but random sites all along the genomic DNA as well. So I think that the main reason that your particular primer is used is because it is in a conserved region AND because it seems to be unique. If it were unknown whether or not there were multiple regions that bind the primer, then you would have had to use multiple primers (nested primers): http://en.wikipedia.org/wiki/Nested_pol ... n_reaction, which is not all the much more complex, but requires two sets of primers.

Hope this helps!
Aaron Lin
Hope this helps!
Aaron Lin
KIRAN DEEPIKA
Posts: 83
Joined: Sun Jan 17, 2010 3:33 am
Occupation: Student:12th grade
Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
Project Due Date: April 20, 2010
Project Status: I am conducting my experiment

Re: CHLOROPLAST SEQUENCING

Post by KIRAN DEEPIKA »

Thank you Aaron Lin sir... :D
I was already convinced with the answer which Donna Hardy & Caroline mam gave.. :wink:

But your answer for the use of primers is more convincing.. :P
Thank you a million tons for answering my questions even after getting a reply from other experts..
It meant a lot to me..
ScienceBuddies is truely Awesome...
Everyone are lending a helping hand :D

Thanks for liking the project & appreciating my efforts as well..
I will come back when i am in doubt..
Good day sir.. :D
KIRAN DEEPIKA
Posts: 83
Joined: Sun Jan 17, 2010 3:33 am
Occupation: Student:12th grade
Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
Project Due Date: April 20, 2010
Project Status: I am conducting my experiment

Re: CHLOROPLAST SEQUENCING

Post by KIRAN DEEPIKA »

Hi...

Durin Isolation of plant genome, I could not fully complete it in one day as my school ended that day..
This was day one's progress -
1. Gather healthy green leaves from two medicinal plants.
2. For each sample, pipette 200 μl of sterile double-distilled water (ddH2O) into a PCR tube.
3. Grind 200 mg of plant tissue to a fine paste in approximately 500 μl of CTAB buffer.
4. Transfer CTAB/plant extract mixture to a microfuge tube.
5. Incubate the CTAB/plant extract mixture for about 15 min at 55o C in a recirculating
water bath.
6. After incubation, spin the CTAB/plant extract mixture at 12000 g for 5 min to spin
down cell debris. Transfer the supernatant to clean microfuge tubes.
After this step,i stored it in 4degrees refrigeration... Then in 15 hours later, i continued with the isolation from where i left i.e. ...
7. To each tube add 250 μl of Chloroform : Iso Amyl Alcohol (24:1) and mix the
solution by inversion. After mixing, spin the tubes at 13000 rpm for 1 min.
8. Transfer the upper aqueous phase only (contains the DNA) to a clean microfuge
tube.
9. To each tube add 50 μl of 7.5 M Ammonium Acetate followed by 500 μl of ice cold
absolute ethanol.
10. Invert the tubes slowly several times to precipitate the DNA. Generally the DNA can
be seen to precipitate out of solution. Alternatively the tubes can be placed for 1 hr at
-20 o C after the addition of ethanol to precipitate the DNA.
11. Following precipitation, the precipitate can be isolated by spinning the tube at 13000 rpm for a
minute to form a pellet. Remove the supernatant and wash the DNA pellet by adding
two changes of ice cold 70 % ethanol.
After the wash, spin the DNA into a pellet by centrifuging at 13000 rpm for 1 min.
Remove all the supernatant and allow the DNA pellet to dry (approximately 15 min).
Do not allow the DNA to over dry or it will be hard to re-dissolve.
12. Resuspend the DNA in sterile DNase free water (approximately 50-400 μl H2O; the
amount of water needed to dissolve the DNA can vary, depending on how much is
isolated). RNaseA (10 μg/ml) can be added to the water prior to dissolving the DNA
to remove any RNA in the preparation (10 μl RNaseA in 10ml H2O).
13. After resuspension, the DNA is incubated at 65o C for 20 min to destroy any DNases
that may be present and store at 4o C.
Will i get good results???Hope i dont screw up anything as i have got my COSTLY primers & i will be using them on the isolated genome tommrow..
I just want conformation whether the DNA i have got can be used to carry out further analysis..
I was little skeptical about going further as i will be using da COSTLY PRIMERS..
Please HELP!!!

Thank you for your time in reading this...
donnahardy2
Former Expert
Posts: 2671
Joined: Mon Nov 14, 2005 12:45 pm

Re: CHLOROPLAST SEQUENCING

Post by donnahardy2 »

Hi Kiran,

This was a lot of work, but it sounds like you are making progress. I do have a suggestion for you to check your sample before proceeding.

Just a minor detail on the protocol. Between step 6 and 7, there is typically a phenol/chloroform extraction step to separate the protein from the DNA. An equal volume of 1 part phenol: 1 part chloroform is added to the sample and it is mixed gently. Then the IAA: phenol chloroform 24:1 step ( one volume IAA:P/C to one volume sample) is used to precipitate the protein, which is then removed by the 13,000 centrifugation step. The DNA remains in the aqueous phase, and you need to be careful not to disturb the interphase between the DNA and protein to avoid contaminating the DNA.

I don't know what effect using chloroform instead of phenol/chloroform would be. It might not remove as much protein as you would expect. Or, since plants typically don't have as much protein as animal tissue, maybe it wouldn't make any difference.

To verify that your samples are suitable for the next step, I recommend that you check the purity of your DNA before proceeding. Do you have access to a spectrophotometer? If so, then do a 260/280 nm ratio to compare the ratio of DNA to protein. The ratio should be between 1.8 and 2.0. If the ratio is lower, then do try doing the phenol/chloroform extraction step to remove the protein from your sample. You want the DNA to be as pure as possible.

Be very careful when working with phenol; it is very caustic.

Let me know if you have any questions.

Donna Hardy
KIRAN DEEPIKA
Posts: 83
Joined: Sun Jan 17, 2010 3:33 am
Occupation: Student:12th grade
Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
Project Due Date: April 20, 2010
Project Status: I am conducting my experiment

Re: CHLOROPLAST SEQUENCING

Post by KIRAN DEEPIKA »

Hi Donna mam... :D
I will try finding out about Phenol and chloroform mixture from my teachers & let you know my progress for the day...
We have a spectrophometer in School.. I will check for the absorbance as you explained.. :)

I have also planned to do this today in school to check DNA quality..
Hope you like this protocol mam.. :oops:
DNA quality confirmation
– Prepare a 1 % solution of agarose by melting 1 g of agarose in 100 mL of 0.5x TBE
buffer in a microwave for approximately 2 min. Allow to cool for a couple of
minutes then add 2.5 μl of ethidium bromide, stir to mix.
– Cast a gel using a supplied tray and comb. Allow the gel to set for a minimum of 20
min at room temperature on a flat surface.
– Load the following into separate wells
10 μL 1kb ladder
5 μL sample + 5 μL water + 2 μL 6x Loading Buffer
– Run the gel for 30 min at 100 V
– Expose the gel to UV light and photograph (demonstration)
– Confirm DNA quality, presence of a highly resolved high molecular weight band
indicates good quality DNA, presence of a smeared band indicates DNA
degredation.
Thank you for your suppport, mam.. :D
I am sure i can count on you when i am in doubt... 8)
I will reply with my progress in 12 hours... :wink:

I have school now.. BYE mam... :P
carolinethorn
Former Expert
Posts: 393
Joined: Tue Sep 20, 2005 2:40 pm

Re: CHLOROPLAST SEQUENCING

Post by carolinethorn »

Hi Kiran,

The protocol for testing on a gel looks good. Is this your first time to run a gel? If so, may I suggest you practice loading some water plus loading buffer in one or two wells before you load your real sample. It can be tricky getting the pipette into the well just right the first time you try so its nice to have a practice and the combs you have probably have 8 or 10 wells and you only need to use 2 for the real sample and ladder.

Good luck with your gel and trying the spectrophotometer.

-Caroline
aelin
Former Expert
Posts: 78
Joined: Sun Sep 27, 2009 6:50 pm
Occupation: Student: Junior in College
Project Question: Role of viral proteins in the HSV1 life cycle, specifically during entry and egress.
Project Due Date: n/a
Project Status: Not applicable

Re: CHLOROPLAST SEQUENCING

Post by aelin »

Hi Kiran,

Also, one quick safety note (so that you don't die an early death like I probably will ><). Ethidium bromide is thought to be fairly carcinogenic because of the way it works (by wedging itself between base pairs in a DNA helix, potentially causing mutations), so I would use as little as possible. For 100 mL of your agarose solution, I would only recommend adding 1 uL or 1.5 uL at most, and this should be plenty enough to get nice, bright bands. So, be sure to wear gloves and avoid touching or inhaling the the ethidium bromide AS WELL AS THE GEL as you work with it.

Hope this helps!
Aaron Lin
Hope this helps!
Aaron Lin
donnahardy2
Former Expert
Posts: 2671
Joined: Mon Nov 14, 2005 12:45 pm

Re: CHLOROPLAST SEQUENCING

Post by donnahardy2 »

Hi Kiran,

Caroline and Aaron have confirmed that your testing procedure is good, and I completely agree with them. The only other detail I can add is that 20 minutes is the very minimum time you should use to allow the gel to set. It will be much better if you let it gel for an hour or more.

Good luck!

Donna Hardy
KIRAN DEEPIKA
Posts: 83
Joined: Sun Jan 17, 2010 3:33 am
Occupation: Student:12th grade
Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
Project Due Date: April 20, 2010
Project Status: I am conducting my experiment

Re: CHLOROPLAST SEQUENCING

Post by KIRAN DEEPIKA »

Hi..
Thanks a million tons for this reply..
This is the first time i am getting Replies from 3 different people...
I am very honoured...

@ Caraline mam..
I have run gels before.. Thank you for approving the protocol and for your advice..

@Aaron Lin..
Thanks for the safety advice.. I will never die because of carcinigens.. Thanks to you and my teachers..

@Donna mam..
Thanks for Everything..
I love your support...

I will definately come back again in doubt...Thank you all..
KIRAN DEEPIKA
Posts: 83
Joined: Sun Jan 17, 2010 3:33 am
Occupation: Student:12th grade
Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
Project Due Date: April 20, 2010
Project Status: I am conducting my experiment

Re: CHLOROPLAST SEQUENCING

Post by KIRAN DEEPIKA »

Hi,
I have a doubt..
I finished with the DNA isolation.. But the quantity of DNA that i got was around 100micro litres..
I have 2 eppendroff tubes with 100 microlitres of DNA of each of the 2 plants. So i have 4 DNA samples in total..
Is it enough for Quantification of DNA (protocol mentioned before) or Spectrophotometer analysis..
And most importantly, after i finish with the quantification, will i have enough DNA left for PCR amplification???

Is it advisable to skip the Quantification step??
Because i bought the primers from a company and i would want to start with PCR amplification. I am worried because i have kept my DNA samples in the refridgerator at 4degrees temperature for 3 days now.. Will it denature?? I would want the best results out of this project.. Please help me in this..

And I am also a little skeptical to do the quantification because of the quantity that we have got..
Please answer me in this as well..

Thank you again...
donnahardy2
Former Expert
Posts: 2671
Joined: Mon Nov 14, 2005 12:45 pm

Re: CHLOROPLAST SEQUENCING

Post by donnahardy2 »

Hi Kiran,

You really can't skip the quantitation step, otherwise you won't know what happened if the PCR step fails. If you do confirm you have good quality DNA, then you will be assured that the PCR step will be successful.

Maybe you could just run a gel instead of doing the absorbance step; that won't consume so much of your samples. A 100 uL volume should be plenty, provided there is DNA in the sample.

Samples for PCR should be stored in the freezer if they are not used right away, so you should freeze the samples as soon as possible if you can't continue the experiment right away.

Donna Hardy
KIRAN DEEPIKA
Posts: 83
Joined: Sun Jan 17, 2010 3:33 am
Occupation: Student:12th grade
Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
Project Due Date: April 20, 2010
Project Status: I am conducting my experiment

Re: CHLOROPLAST SEQUENCING

Post by KIRAN DEEPIKA »

Hi Donna mam.
Thank you for your reply.. :D
I will do the Quantification step tomrrow for sure.. :P
Can you tell me the quantity of the DNA sample required for running the gel?? :?:

If i dont get dark bands, what should i do?? :!:
I want the best DNA possible before i use my primers on them because the primeres are really costly.... :(
donnahardy2
Former Expert
Posts: 2671
Joined: Mon Nov 14, 2005 12:45 pm

Re: CHLOROPLAST SEQUENCING

Post by donnahardy2 »

Hi Kiran,

Why don't you try loading 10 uL, or 10% of your total sample volume? The ethidium bromide will allow you to detect as little of 1 to 5 ng DNA per band. Theoretically you can obtain good results with very small amounts of DNA, but you want high quality DNA to start with. If you don't have detectable DNA in your sample, you will have to start over again, but if you do have DNA you can proceed with the next step.

If you have question about your results, and there is no one available to help you interpret the gel, it would be very helpful if you could take a picture of the gel and upload it so we can see it. If you can't do this, then try to describe the bands as well as possible. Do you have any type of control DNA to run on the gel along with your sample?

Donna Hardy
KIRAN DEEPIKA
Posts: 83
Joined: Sun Jan 17, 2010 3:33 am
Occupation: Student:12th grade
Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
Project Due Date: April 20, 2010
Project Status: I am conducting my experiment

Re: CHLOROPLAST SEQUENCING

Post by KIRAN DEEPIKA »

Hi..
Thank you for the advice Donna mam.. :D
I was all ready for running the gel today.. But my principal insisted on going for a simplier method.. So now i had to go for Spectrophotometer reading instead.. :x

Can you please give me the protocol for UV-Visual Spectrophotometer (which is in my school) on how to go about using my DNA sample for quantification..
I am not sure about using the instrument.. But i will have my guide to help me out..
But i would want to prepare myself before hand..

I did not find the right procedure (along with quantities) for this quantification through Spectrophotometer in google.. :(
Please help me.. :roll:

Thank you tons..
donnahardy2
Former Expert
Posts: 2671
Joined: Mon Nov 14, 2005 12:45 pm

Re: CHLOROPLAST SEQUENCING

Post by donnahardy2 »

Hi Kiran,

Measuring the optical absorbance at 260 and 280 nm will help you evaluate the purity of the DNA. Do you have the instruction manual for your spectrophotomer? If not, then try to find it on the internet and read the directions.

What volume of quartz cuvettes do you have? You should have a pair of matched cuvettes. Use one as a reference and fill it with water. Then, you can use 3-5 uL of you sample and dilute it in water to fill the other cuvette. Measure the absorbance at 260 nmn and 280 nm and calculate the ratio. The ratio should be >1.8.

Be sure to put your sample in the freezer after to test it. Let me know about your result.


Donna Hardy
KIRAN DEEPIKA
Posts: 83
Joined: Sun Jan 17, 2010 3:33 am
Occupation: Student:12th grade
Project Question: Chloroplast Sequencing to find Evolutionary relationship between Medicinal plants..
Project Due Date: April 20, 2010
Project Status: I am conducting my experiment

Re: CHLOROPLAST SEQUENCING

Post by KIRAN DEEPIKA »

Hi Donna mam..
What about the calculation part,mam..?? Wont they change after diluting it..??
How do we go about doing the calculations after diluting the sample.??

Our cuvette volumes are 3ml..
Our school doesnt have the computerised spectrophotometer. Only protocol for this is available in google.. Not the one i require.. :(
The spectrophotometer in our lab is the basic manually operated one wherein you set the wavelength, calibrate using the dummy n the blank,place the cuvette and take reading of the sample..my teacher's are willing to explain the working of the instrument but i have huge doubts concerning calculations..i need your help with that..or should i get back to you with the absorbance values..????

Do you think the GEL method is better or the spectrophotometer???
Please help with all my queries..

Thank you..
Seeking your reply.. :D
Locked

Return to “Grades 9-12: Life, Earth, and Social Sciences”