The following are the steps that we are performing:
FIRST, the spectrophotometer has to be warmed up for 5 - 10 minutes. This is to stabilize the machine and avoid fluctuations in the readings.
SECOND, select the wavelength to be used. This is done by making use of the wavelength selector knob which is one of the operating features of a spectrophotometer.
THIRD, prepare the unknown solution to be read by wiping the cuvete gently with a fine cloth or tissue paper, before transferring the unknown solution . (Never brush your cuvete as scratching on the surface of the glass may cause inaccurate readings.)
FOURTH, place the cuvete in the cuvete well/cell well properly. Be sure to follow any instructions with regards to the positioning of the cuvete.
FIFTH, adjust the mode control knob to 0.0 - if you are utilizing the absorbance measurement and 100 % - if you are using % transmittance. Use a water or reagent blank to adjust the spectrophotometer to these readings.
SIXTH, take note of the absorbance or transmittance readings which will be reflected on the digital read out device or in the display window.
N.B. Take at least 2-3 readings of your unknown and be sure to adjust the spectrophotometer to 0.0 for absorbance and 100 % for transmittance, before each reading. (This is to read out errors caused by the machine or by the color of the reagent itself.)
SEVENTH, take the averages of your two or three readings and compute for the unknown concentration making use of this formula. Cu = Au /As x Cs
Where: Cu = Concentration of Unknown
Au = Absorbance of Unknown
As = Absorbance of Standard
Cs = Concentration of Standard
WHICH IS D STANDARD IN D FORMULA THEY HAVE GIVEN?
Can you please explain the calculation part with an example or bleep..
Please reply.. In 8 hours i have to perform this on lab..
Thanks for your time..
The purpose of the OD260/280 is to measure the purity of the DNA; you want to use as little sample as possible to do this measurement, so try diluting 5 ul into 3 ml of water. You definitely don't need a computerized spectrophotometer for this measurement. If the readings are too low, then add another 5 uL of your sample, mix well, and do another reading at both 260 and 280 nm. Definitely, let me know about your results.
Don't worry. You will still have plenty of sample left for the PCR.
Running the gel will tell you if the DNA is degraded, and would be useful to know, but you can proceed with the cloning if you can verify high purity with the 260/280 ratio.
Hi Donna mam,
Thank you for the reply.. Please explain the calculation part.. Is it only simple division??? What are the values for the terms in the formula?? How are we supposed obtain them???
I mean this formula -
Cu = Au /As x Cs
Where: Cu = Concentration of Unknown
Au = Absorbance of Unknown
As = Absorbance of Standard
Cs = Concentration of Standard
I dont know the concentration or the absorbance of the standard..
Please help.. Sorry for so many doubts..
My teachers will guide me tomorrow.. But i want to be prepared before hand..
Thanks a millions for your help..
Your procedure is a good one, but you don't need to use the formula given here, because you won't be making a standard curve. With some applications run on a spectrophotometer, you measure the absorbance of several standards with known concentration, and then measure the absorbance of unknowns. The concentration of the unknown is determined by interpolating from the standard curve.
Your application is easier than this. You will measure the absorbance of your diluted sample at OD 260; then change the wavelength and measure it at 280. Then divide the OD 260 by the OD 280. This gives you the ratio of DNA to protein. If the ratio is greater than 1.7, then you have high purity DNA. You don't need to test 3 separate samples; one sample will be enough for this application.
I hope this is enough information. Let us know about your results.
I'm sorry this is so confusing. Disregard the formula you have found. You don't have a standard so you can't use the formula. You can only measure the OD of your sample, but that will be sufficient for the application.
I did the Quantitative test for DNA as you said, today.. I got 260/280 OD ratio to be in the range of 1.0 to 1.1 for both the plants
Our lecturers said getting 1.3 ratio is the best we can expect in our lab conditions..
So to get these results, they suggested me to again perform the experiment from Phenol & Chloroform:isoamyl alcohol mixture part again.. ( as givin in the previous post)..
We did that, but we did not get the pellet this time..
So now we are planing to start all over again from the beginning.. Please give me some tips such that i dont screw it up again..
I really dont know where i went wrong..
My teachers told me not to give up hope as the DNA is there in the solution itself.. After storing it in 4degrees overnight mixed with TE buffer, i will get the DNA to precipitate itseems..
Tomorrow I will do the thing as said by my teachers ..
But i will make a backup by restarting the experiment from the beginning..
Please suggest me how to incease the purity of the DNA..???
Thank you mam..
I am working on a detailed response for you, but it would be helpful to know the following:
1. What were the OD 260 and 280 readings?
2. Are you using a microcentrifuge?
3. Can you obtain phenol for the DNA precipitation?
4. What was the volume of your sample before you added the isoamyl/chloroform?
5. After the chloroform extraction, did you recover the top or the bottom phase from the tube?
6. When you were removing the aqueous layer, did you remove all of the water, or did you leave a few microliters (10-20 microliters) behind?
7. What color was the DNA pellet (white, or not-so-white)?
Here are some suggestions that will improve your results with the second trial. I have copied your protocol and added comments in parentheses:
Gather healthy green leaves from two medicinal plants.
2. For each sample, pipette 200 μl of sterile double-distilled water (ddH2O) into a PCR tube. (If your OD 260/280 was low, you can double the amount of starting plant material to increase your yield)
3. Grind 200 mg of plant tissue to a fine paste in approximately 500 μl of CTAB buffer. (Did you try to find dry ice to help break down the cell wall? If you don’t have dry ice, then perhaps increase the grinding time at this step).
4. Transfer CTAB/plant extract mixture to a microfuge tube.
5. Incubate the CTAB/plant extract mixture for about 15 min at 55o C in a recirculating
water bath.
6. After incubation, spin the CTAB/plant extract mixture at 12000 g for 5 min to spin
down cell debris. Transfer the supernatant to clean microfuge tubes.
After this step,i stored it in 4degrees refrigeration... Then in 15 hours later, i continued with the isolation from where i left i.e. ...
7. To each tube add 250 μl of Chloroform : Iso Amyl Alcohol (24:1) and mix the
solution by inversion. After mixing, spin the tubes at 13000 rpm for 1 min. (The chloroform extracts the protein from the DNA, so make sure this is well mixed. Were you able to locate phenol so you can use a mixture of phenol:chloroform? ).
8. Transfer the upper aqueous phase only (contains the DNA) to a clean microfuge
tube. (The protein is removed from this step and the protein is very concentrated at the top of the chloroform layer; leave 10-20 uL of the aqueous phase to minimize contamination of the DNA with the protein).
9. To each tube add 50 μl of 7.5 M Ammonium Acetate followed by 500 μl of ice cold
absolute ethanol. (you should add 1/5 of the total volume of ammonium acetate; then fill the microtube with the cold ethanol; make sure you use the 100% ethanol for this step. ).
10. Invert the tubes slowly several times to precipitate the DNA. Generally the DNA can
be seen to precipitate out of solution. Alternatively the tubes can be placed for 1 hr at
-20 o C after the addition of ethanol to precipitate the DNA.
11. Following precipitation, the precipitate can be isolated by spinning the tube at 13000 rpm for a
minute to form a pellet. Remove the supernatant and wash the DNA pellet by adding
two changes of ice cold 70 % ethanol.
After the wash, spin the DNA into a pellet by centrifuging at 13000 rpm for 1 min.
Remove all the supernatant and allow the DNA pellet to dry (approximately 15 min).
Do not allow the DNA to over dry or it will be hard to re-dissolve.
12. Resuspend the DNA in sterile DNase free water (approximately 50-400 μl H2O; the
amount of water needed to dissolve the DNA can vary, depending on how much is
isolated). RNaseA (10 μg/ml) can be added to the water prior to dissolving the DNA
to remove any RNA in the preparation (10 μl RNaseA in 10ml H2O). (Since you are using the DNA for PCR, you don’t have to do the RNase step)
13. After resuspension, the DNA is incubated at 65o C for 20 min to destroy any DNases
that may be present and store at 4o C.
(If you do use the RNase, then zero the spectrophotometer with the RNase solution; this will avoid including the RNase in the OD 280 reading).
Extracting DNA requires developing your technique, and I’m sure your results will be better with the next trial.
Hi Donna mam..
Thanks for your detailed explainations on my protocol.. Sorry for the delayed reply.. I was meeting some people on my project matters..
Your questions :
1. What were the OD 260 and 280 readings?
2. Are you using a microcentrifuge?
3. Can you obtain phenol for the DNA precipitation?
4. What was the volume of your sample before you added the isoamyl/chloroform?
5. After the chloroform extraction, did you recover the top or the bottom phase from the tube?
6. When you were removing the aqueous layer, did you remove all of the water, or did you leave a few microliters (10-20 microliters) behind?
7. What color was the DNA pellet (white, or not-so-white)?
Answers for your questions are :
1. We used 2 eppendroff tubes for each plant.. 260280 Centella 1 0.073 0.068 Centella 2 0.055 0.05
Leucas 1 0.083 0.077 Leucas 2 0.064 0.056
2. I am not sure about the name of our Centrifuge.. It is a centrifuge that holds 1.5ml eppendroff tubes and there are 12 slots for the tubes to put in..
3. I did not understand your question.. How should we obtain Phenol in DNA precipitation??
4. 20uL
5. Top layer
6. Around 20uL was left..
7. Both Centella samples gave creamish yellow-white pellets while Leucas gave green pellets..
I have more doubts..
1. How many times should we repeat the Phenol:Chloroform Step??
2. The lecturers that i met told me that i should use liquid Nitrogen for this (which is difficult to obtain because of time constraint) or store both the plants & Mortar-pestle in -20degrees temp for an hour before starting the grinding work.. I have brought my plants & have put it in my refrigerator (4degrees) now itself.. So that in 12 hours, i put the plants in 20degrees for an hour before starting with the grinding work.. Is dis right?? Or should i modify any step??
3. Should i use water or TE buffer as my blank in my MANUAL SPECTROPHOTOMETER..?? We dont hav RNase free water as its too costly
4. Should i store the pellet in TE buffer or Milli-Q water after obtaining the DNA pellet???
In 15 hours, i will start my isolation work again & keep in mind the suggestions you have given me in the previous posts..
Thanks for your unlimited support..
Hi Kiran,
Thanks for the replies. These are very helpful in letting me know what is happening.
1. We used 2 eppendroff tubes for each plant..
260 280
Centella 1 0.073 0.068
Centella 2 0.055 0.05
Leucas 1 0.083 0.077
Leucas 2 0.064 0.056
Comment: You are recovering plenty of DNA for the PCR part of the experiment; you will need to prepare a cleaner sample without so much protein in it.
2. I am not sure about the name of our Centrifuge.. It is a centrifuge that holds 1.5ml eppendroff tubes and there are 12 slots for the tubes to put in..
Comment: This is exactly the type of centrifuge that is normally used for this type of experiment.
3. I did not understand your question.. How should we obtain Phenol in DNA precipitation??
Comment: I have never done an extraction with chloroform alone. Since you don’t have the phenol reagent available, you will have to omit this reagent from the extraction step. It’s possible that chloroform will work well with plant samples.
4. 20uL
Comment: This is OK.
5. Top layer
Good. This is correct.
6. Around 20uL was left..
Domment: This is good because it means that you avoided picking up the concentrated protein from the top of the chloroform layer. Maybe you should leave about 10 uL more on your next trial.
7. Both Centella samples gave creamish yellow-white pellets while Leucas gave green pellets.
Comment: DNA is white, so maybe you should mix the chloroform and aqueous layer a little longer to try and extract more of the chlorophyll. I don’t know if this will help, but it won’t damage your sample.
I have more doubts..
1. How many times should we repeat the Phenol:Chloroform Step??
Answer: Just one time is sufficient.
Answer: Maybe adding more chloroform and increasing the extraction time will help.
2. The lecturers that i met told me that i should use liquid Nitrogen for this (which is difficult to obtain because of time constraint) or store both the plants & Mortar-pestle in -20degrees temp for an hour before starting the grinding work.. I have brought my plants & have put it in my refrigerator (4degrees) now itself.. So that in 12 hours, i put the plants in 20degrees for an hour before starting with the grinding work.. Is dis right?? Or should i modify any step??
Answer: Freezing the sample will help break down the plant cell wall, so this was a good suggestion. Plant cells are very tough and a freezing step will help extract more DNA.
3. Should i use water or TE buffer as my blank in my MANUAL SPECTROPHOTOMETER..?? We dont hav RNase free water as its too costly
Answer: Yes, use the TE buffer. It’s OK that you don’t have RNase free water.
4. Should i store the pellet in TE buffer or Milli-Q water after obtaining the DNA pellet???
Answer: TE buffer is fine.
I think you realize that successfully extracting the DNA is very depending on the technique. So good luck to you tomorrow! Let me know about your results.
Hi Donna mam.. Thank you for comforting me with such a detailed reply.. I am amazed to know that you are helping a total stranger to such a great extent..
Wish to meet you mam.. But I know revealing & asking for email ID z against ScienceBuddies rules..
Anyways i will definately put your name as my external guide in my PROJECT REPORT..
I will let everyone know about your contribution for my project..
I cant thank you enough,mam..
I made a mistake while answering this question:
4. What was the volume of your sample before you added the isoamyl/chloroform?
Answer is 200uL not 20uL.
Hope this is right as well..
I will certainly reply the very minute i return back home mam.. Thank you mam with tears and smiles
Thanks for your reply. You are very welcome! Our goal at science buddies is for you to be successful in doing your science project, and I am confident that with your diligence in understanding the details of this project, your results will be improved in the next trial.
200 uL is definitely better than 20 uL. You will have plenty of DNA in your sample.
Except Leucas 3 (which agve negative values), all gave decent values as shown..
I will be having my Pre-project presentation the next monday.. So i wont be using the DNA for PCR (which is the next step) for another 10 days.. Will the quality of the DNA be affected??
Can i carry out the PCR with such ratio values (even though they are not over 1.7)
Thank you Donna mam for ur help.. I guess without your support i would have faced lots of trouble...
Your detailed Protocol helped me a lot..
I will be looking forward for your help during PCR & Gel Electrophoresis..
I owe my tonight's sound sleep to you mam..
Congratulations! Your results are better and you definitely have enough DNA for the PCR part of the experiment. Thanks for posting the details of your measurements; these are very helpful. It would be better if the 260/280 ratios were higher, but I think that with using chloroform alone, this is probably the best possible results that can be obtained. I know that we covered all of the details of the extraction to look for any other possibilities. I would recommend doing one PCR experiment to see if you can get usable material. If it is not successful, then you will have to do the extraction again, and if you do repeat it, I would recommend repeating the chloroform extraction to see if you can remove more of the protein and chlorophyll. You can also increase the volume of the aqueous phase.
Since it is going to be a while until you get to the next step, you should freeze your samples.
I know you will be busy preparing for your presentation for the next few days. Good luck!
Do let me know when you are ready for the PCR and gel electrophoresis part of the experiment. I will look forward to hearing from you.
Hi Donna mam..
I am in big trouble..
I am planing to do the PCR part of my project tomorrow itself as the PCR is available only tomorrow.. So i was preparing myself with the Primer Data sheet which i got from the company wher i ordered my primers.. I am having trouble understanding the manual.. Please help me whats the quantity of primers to be used by looking at the data sheet given below..
The primers are in lyophilised form & Sould be diluted with TE buffer or water..
The data sheet for one of the primers is as follows..
Forward primer 1 : ATGTCACCACAAACAGAAAC
length = 20
purity = DST (desalted)
Scale = 0.0255uMol
Mol wt = 6072
melting telp = 57.3
ug/OD = 29.476
OD = 9.7
ug = 287
nMol = 47.2
Dimer = no
Secondary = very weak
GC % = 40
uL for 100uM = 472
I have bought the PCR kit.. And the manual procedure is as follows..
Nuclease free water = 37uL
10X TAQ polymerase assay buffer = 5uL
dNTPs = 2uL
forward primer = 2uL
reverse primer = 2uL
DNA template = 1uL
TAQ DNA polymerase = 1uL
Total reaction vol = 50uL
Please help me in understanding this mam.. Because i have bunked School today & i have only tomorrow to work with the PCR for free.. & i will be bunking my classes tomorrow to perform PCR in lab.. I want to know how to go about doing PCR.. Is the quantity given by the company is sufficient for the PCR requirements as mentioned in the PCR kit manual..?Please reply as soon as possible.. I will be checking for your reply every 2 hours from now..
I checked Google as well to understand the data sheet & spoke to the company people as well but i was unsuccessful..
My guide in school will be absent tomorrow.. So i have no one but you to count on..
Please help your Student..
Thank you.. Thanks tons..
Don't freak out! It's good you thought to check this before and you still have plenty of time. You should have all the information still to get this to go right. And you have plenty of primers to do many PCR reactions.
Thanks for posting the copy of the primer label as it has all the info to help us make the right concentration solution. Look at the last line of it. It says how much water or buffer to add to make a 100micromolar stock. This is what you should do first - make a 100micromolar stock using the number of microliters of double distilled water it says : adding 472 microliters for primer 1 directly the the tube with the dried primer in and mixing well.
The second primer will have a slightly different number as there is probably slightly different amount in the tube.
This is your concentrated stock for storage, when you have diluted a portion of it store at -20C.
Then you will make a working stock concentration that you will use for the PCR reaction. Double check the protocol with your PCR kit to see what concentration of primers they suggest for the PCR reaction (it didn't show it in the excerpt you posted but might be elsewhere in the booklet). I would think it will be 10 micromolar as that is very common. If you were making 10micromolar working stock you would take a fresh tube, add 10 microliters of your concentrated 100micromolar stock and 90micromolar or water or buffer. Then that would be ready for adding to the PCR reaction. If the PCR kit recommends a different concentration of primer then we can work out how much to dilute concentrated stock by.
Caroline has given you some excellent suggestions. And I agree that it is good you are reviewing the protocol in advance.
I have the following additional comments.
The procedure you have posted from the manual is for a single reaction mixture. You should add the components for each reaction in the order given, and mix gently by tapping the bottom of the tube. You should do a minimum of two reactions for each sample and you should include one negative control (no DNA) to make sure none of your reagents is contaminated. I don’t think you have a way of doing a positive control.
Do you have someone who can help you program the PCR instrument tomorrow? You will need to know the optimum temperature for the Taq polymerase, and program the cycles for the denaturing, annealing, and elongation steps.
What company did you purchase the PCR kit from? Do they have an instruction manual posted on their website? Please let us know the details.
Please relax. I’m sure this will turn out well. However, I’m concerned that you are missing school for two days. Science fair projects are important, but so are all of your other classes.
Hi Donna mam..
I cant thank you enough..
The PCR kit is from the company - Genei Student PCR Kit 2 & I have the instruction manual along with me..
The follwoing link shows the e-copy of what i am using..
Hope this helps & answers all your queries about the temperature setting & all.. http://www.bangaloregenei.com/teaching-kits/KT44.pdf
I will try to speak to my Head mistress to help me with PCR settings.. Today i handled the instrument setting.. But i was little worried about the Primer usage..
So i had to come to ScienceBuddies..
I am doing Gel electrophoresis the next week.. After PCR amplification,is it alright to store the PCR products in 4degrees from tomorrow to another 8days??
I missed today's class & will miss tomorrow as well.. But i promise to make up the classes in the coming weeks..
Thank you for your concern mam.. Its really nice of you..
Hi Caroline mam..
Thank you for the immediate reply..
Hope the above link gave the information you are looking for mam..
Thanks for the details in preparations..
I have another doubt..
The manual says - a thin layer of mineral oil is added depedin on the type of the instrument.. What to do about this??
I dont know the type of our PCR instrument.. When should this be added & how?? Why is this added..
Sorry for not doing my homework now..
I was stuck in finding the PCR dilutions till your replies came.. & i found this..
Please approve this as well..
Preparation of Stock PCR Primers
Always take great care not to contaminate the original primer stock - use filter tips and PCR-quality reagents
1. When you receive the lyophilized primer, before opening it be sure to spin it down to insure that the primer pellet is at the bottom of the tube.
2. Prepare the 100 uM primer stock solution in the tube containing the pellet. This tube will be used to make working primer solutions as needed and will be stored at -20°C or below.
To prepare stock:
Determine how many nmoles of primer is in the tube (usually written on the tube or on information accompanying primer order).
Resuspend the pellet in CLEAN 10mM Tris, pH 8.8 buffer to generate the 100uM stock solution. An easy way to do this is to multiply the nmole value by 10 and add that volume in ul to the pellet.
Example: If primer pellet is 8.3 nm, you will add 83 ul 10mM Tris, pH 8.8 buffer to the pellet to resuspend it. The final concentration of primer is 100 uM.
3. To generate the 20 uM working dilution of the primer, dilute the stock solution 1:5 with 10mM Tris, pH 8.8. Example: 10ul stock + 40ul 10mM Tris buffer.
I understood the calculation part through some exmples given in Google Search..
But still Thanks for answering all my doubts mam.. I had plans to do PCR in 10 days after my pre-project presentation.. But due to free availability of PCR, I made up my mind to finish it off by tomorrow.. Thank you for your support.. I am happy that both of you replyed to comfort me..
Please let me know if there is anythin else i should submit here..
Please answer my questions as well..
Hope you liked the manual..
Hi again..
I will be doing 3 samples for each plant.. There are 2 plants..
And there will be 1 negative.. So there will be a total of 7vials for PCR.. Thank you both Caroline & Donna mam..
I will be looking forwqard for your reply..
I am working on a response for your questions, but I am wondering what type of PCR instrument you have available. If it has a heated lid, then you won't need the mineral oil. However, if it only has a heating block, then you will need to use this. What is the brand and model of the PCR instrument?
Hi Donna mam..
I dont know the brand or the model of our PCR machine..
But i will find out from my head mistress & work on it..
I will report you tomorrow's progress in 20 hours..
Thanks for everything..
Hope the link was helpful in helping me out.. I will be sleeping now.. I have a hectic day tomorrow morning..
I am very excited about the project now..
Hi..
I woke up to type this post as another doubt just striked me..
You had said that minimum 2 reactions must be carried out in the PCR machine.. What do you mean by this??? Because even my manual says the same thing.. Is it that only 2 vials of 1 sample each must be carried out at a time??
Please make this clear mam..
Tomorrow i will get a maximum of 3hours to work on the PCR after which the PCR wont be free..
Hope this time is sufficient to do PCR and finish if off..
Hi..
There is a small correction..
I will be doing 2 samples each in 2 vials for each of the 2 plants..
That means there will be 1 forward primer for 1st vial & 1 reverse primer for 2nd vial..
So totally there will be 8vials for both the plants & 1 negative..
Hope i am right in what i said..
Please correct me if i am wrong..
Good night..
You have very good questions. Each of your vials will include both the forward and the reverse primer. I think you have the 10-reaction kit, so you can set up 2 samples for each plant plus the negative control, or 5 vials total. That way, if necessary, you will have enough reagents to set up the PCR again. Each tube should contain the following:
Nuclease free water = 37uL
10X TAQ polymerase assay buffer = 5uL
dNTPs = 2uL
forward primer = 2uL
reverse primer = 2uL
DNA template = 1uL
TAQ DNA polymerase = 1uL
Total reaction vol = 50uL
You should store your PCR product at minus 20 degrees C since it will be 8 more days until you can run the gels.
If your PCR instrument has a heated lid and seals the tubes, then you do not need mineral oil, and you should not use it since it can be a source of DNA contamination. If your instrument does not have a heated lid, then you will need the mineral oil, but preferably you should use a new bottle that has not been previously opened.
PCR is very technique dependent, so you should do everything possible to avoid DNA contamination. This includes cleaning your work area with a product like DNA away or 10% bleach. You should wear gloves and a lab coat, and use unopened packages of pipette tips and PCR tubes. You should store all of your reagents on ice, especially the polymerase and the dNTP’s. You should add the dNTP’s to the reaction mixture at the very last, flick the tube, and immediately put it into the PCR instrument and start the first heat cycle.
If you encounter a major obstacle tomorrow, it would be better to postpone doing the PCR rather than using the kit.
Hi Donna & caroline mam..
Today i finished my PCR part of my project..
The PCR run finished in just 2hours 48 mins after following the PCR manual..
Thanks tons for your immense help.. All the suggestions came in handy..
I hope i have got good results.. I will only know after my gel run..
I will do the gel electrophoresis on monday.. I have few doubts in DNA sequencing.. I will ask them tomorrow..
Thanks again..
I have had a very tiring day.. Got to sleep now.. I am very happy that my project is going smoothly now.. I owe my success to ScienceBuddies..
Excellent! I'm very happy that you were able to complete the PCR part of the project. This is a major accomplishment. Please do post all of your questions on the next step tomorrow, so you will be ready to continue on Monday.
Hi Donna mam..
Sorry for the late reply.. I was busy searching for my seminar topics which is a part of the curriculum..
I have decided upon Osteoarthritis & Forensic Toxicology..
I have downloaded most of the pdfs & links fron google.. If you have any other resources related to these topics (like pdfs or links) please help me..
Also i would want to show you my powerpoint presentation & some lab pictures..
How to do it through ScienceBuddies??
Please explain.. Else tell me anyother means of mailing them to you mam..
Thank you..
Hi again.. Tomorrow i will do Gel Electrophoresis..
I will be following the protocol mentioned in ScienceBuddies project - Investigate Native Plant Evolution with Chloroplast Sequencing.
If there's anything else (other than Ethidium Bromide precaution) that i should keep in mind please do letme know.. How do i know that that the electrophoresis has worked well?? What should i do if i dont get a single band upon runnig the gel??
I will be sending my sample for DNA sequencing to a company.. In what form should i send it??
One of my teachers told me Electro-elution.. And another teacher told me this procedure -
1.Prepare gel.. After solidifying make wells..
2.Run gel to quarter distance with DNA & marker..
3.Remove gel & make a well jst a centimeter below the DNA band & fill it with low concentration agarose gel (0.2%)..
4.Run the gel & allow the DNA to get into the low concentration gel.. & stop the run..
Remove the low concentration gel gently & put it into an eppendroff tube & keep in 60degrees for an hour till it melts..
After melting carry out the isolation part from Phenol:Chloroform step till we get the DNA..
Then send this sample for DNA sequencing..
Is this right?? Is there anyother bleep for sending the sample??
I have got it right so far.. I really dont want to screw it up coming this far..
Please help me & comfort me like always..
Hope there's no serious problem if i go wrong in gel electrophoresis or while preparing for Gel electrophoresis..
Please help me.. I am tensed & worried like always..
I want to pass this Gel electrophoresis step with flying colors.. What are the precautions i should take for this??
After this step everything is pretty easy for me..