Bioinformatics Drug Design - Mutation and Procedure Question

Ask questions about projects relating to: biology, biochemistry, genomics, microbiology, molecular biology, pharmacology/toxicology, zoology, human behavior, archeology, anthropology, political science, sociology, geology, environmental science, oceanography, seismology, weather, or atmosphere.

Moderators: AmyCowen, kgudger, MadelineB, Moderators

Locked
deleted-71949
Posts: 59
Joined: Mon Jun 22, 2009 3:55 pm
Occupation: Student: High School Senior
Project Question: Applying evolutionary algorithms to a Monte Carlo Tree Search
Project Due Date: September 20, 2013 (to allow for snail mail, etc.)
Project Status: I am conducting my experiment

Bioinformatics Drug Design - Mutation and Procedure Question

Post by deleted-71949 »

Hi,
I'm thinking of doing a project on a design for a drug for spinal muscular atrophy, but I'm a bit stuck.
Well my main concern is that it doesn't seem to constitute a science fair project because I can only do the bioinformatics part (the deadline is already passed for SRC pre approval projects).

Secondly, and more importantly, I don't really know what to do.
I've read some articles on structural based drug design, but I'm not sure where to start. What I understand is this: I need to identify the gene/mutation that causes the disease, make a 3D or homology model of it, and then use some sort of computational tool to search small molecules that can fill the gap, and then do a series of calculations to see if it's a good fit, and determine if the molecule is toxic/or not. I think this is the sort of series of steps I have read about. I'm not quite sure though. Most of my readings were general information, that didn't really elaborate.

It seems that I need a model of the structure of a mutation that causes the disease, so in this case it would bea mutation of the survival motor neuron protein, or SMN1. I'm not sure about what kinds of programs to use to proceed, though. Also, I am not really finding information on mutations that cause the disease, except here: http://www.hhmi.org/news/pdf/dreyfuss20100301.pdf and here: http://www.fsma.org/UploadedFiles/ForMe ... 111909.pdf

According to those, the mutation is SMN Delta 7, or excision of exon 7. However, it seems that this is on SMN2.
And according to this: http://ghr.nlm.nih.gov/gene/SMN1
the SMN Delta 7 mutation is on BOTH SMN proteins in the majority, 95% of spinal muscular atrophy patients.

SUMMARY: What is the most common mutation that causes spinal muscular atrophy if not SMN Delta 7?
Also, how should I proceed for a drug design (what programs - preferably open ware/free - should I use to do each step)?


Thanks,
blueswim
deleted-71536
Former Expert
Posts: 895
Joined: Tue Sep 06, 2005 3:59 pm
Occupation: Professor
Project Question: How do different animals adapt to their environment?
Project Due Date: N/A
Project Status: Not applicable

Re: Bioinformatics Drug Design - Mutation and Procedure Ques

Post by deleted-71536 »

Hi blueswim,

You have obviously done your homework! This is not my area of expertise, but I know a Ph.D. student working on drug design for his dissertation. I have forwarded him your questions and asked for his advice. I will let you know what he says!

Best,
Heather
deleted-71949
Posts: 59
Joined: Mon Jun 22, 2009 3:55 pm
Occupation: Student: High School Senior
Project Question: Applying evolutionary algorithms to a Monte Carlo Tree Search
Project Due Date: September 20, 2013 (to allow for snail mail, etc.)
Project Status: I am conducting my experiment

Re: Bioinformatics Drug Design - Mutation and Procedure Ques

Post by deleted-71949 »

Many thanks!

blueswim
deleted-71884
Former Expert
Posts: 44
Joined: Fri Jul 15, 2011 2:00 pm
Occupation: Student
Project Question: N/A
Project Due Date: N/A
Project Status: I am conducting my research

Re: Bioinformatics Drug Design - Mutation and Procedure Ques

Post by deleted-71884 »

Hi blueswim,

It's interesting that an expert is asking a question on here! Anyways, you can look on NCBI (go to pubmed and scroll down the list of choices) and type in SMN1 to get what you are looking for. It will be a good jumping off point.

Hope that helps!

-Sam
deleted-71948
Former Expert
Posts: 43
Joined: Sun Jan 16, 2011 12:52 am
Occupation: Student
Project Question: Biochemistry
Project Due Date: Completed
Project Status: I am finished with my experiment and analyzing the data

Re: Bioinformatics Drug Design - Mutation and Procedure Ques

Post by deleted-71948 »

Hi blueswim,

This seems like a very interesting project to carry out!

After reading your post, I did some research on the causes of spinal muscular atrophy.
As you also mentioned, the SMN1 gene(survival motor neuron 1, telomeric) when mutated, is the common cause of spinal muscular atrophy in which exon 7 is deleted in both copies of this gene. When the SMN1 gene is mutated, it is no longer capable of coding the SMN protein. Although infected individuals can temporarily retain at least one copy of the SMN2 gene to sustain the neurons for survival, in the long term, patients will experience reduced levels of SMN protein gradually resulting in death of motor neuron cells and atrophy.

I have found some journals for you to refer to in generating drug design procedures:
Genetic conversion of SMN2 gene to SMN1 : A novel approach to the treatment of spinal muscular atrophy
http://www.img.cas.cz/bact/JournalClub/JC14April08.pdf

Progress and Promise: The Current Status of Spinal Muscular Atrophy Therapeutics
http://www.discoverymedicine.com/James- ... rapeutics/

Quantitative Analyses of SMN1 and SMN2 Based on Real-Time LightCycler PCR: Fast and Highly Reliable Carrier Testing and Prediction of Severity of Spinal Muscular Atrophy
http://www.cell.com/AJHG/retrieve/pii/S0002929707639512

Additionally, in the future, you could also consider researching on actual therapeutic bleep for SMA- ex. prolonging the survival of neurons even with low levels of SMN, fusion or combination therapy, etc.

Hope this helps and good luck!

-Grace
deleted-71536
Former Expert
Posts: 895
Joined: Tue Sep 06, 2005 3:59 pm
Occupation: Professor
Project Question: How do different animals adapt to their environment?
Project Due Date: N/A
Project Status: Not applicable

Re: Bioinformatics Drug Design - Mutation and Procedure Ques

Post by deleted-71536 »

Hi blueswim,

I heard from my friend, who does research on drugs to reverse the effects of sarin gas. He said he is not too familiar with the mechanism causing muscular dystrophy, but you seem to have a good understanding of what needs to be done!

Here is his response:

1) It seems that the exon 7 deletion causes very little SMN to be produced and this could be the major cause of muscular dystrophy. In this case, a drug targeted towards SMN wouldn't work because there is little or no protein to target (http://ghr.nlm.nih.gov/gene/SMN1). But if the deletion causes a loss of amino acids then you'll need to figure out which amino acids are missing. The deletions may be large and cause the protein to not fold properly or not bind to the multiple binding partners that it has been shown to interact with.

2) To do a structural analysis of the protein, it is very helpful to start with a structure that has been solved. There may be a crystal structure of the SMN protein in the pdb (Protein Data Bank). I found only 3 results and one of them may have the full length protein or at least enough of it to use in modeling. http://www.rcsb.org/pdb/results/results ... d=D6049041

3) As for software to do the modeling and binding calculations.
Pymol is one of the best visualization softwares and is free. Using this you can make mutations in the 3-D structure and then use this to perform binding calculations with small molecules. http://www.pymol.org/
To do the binding calculations you can use AutoDock: http://autodock.scripps.edu/

I really hope this helps! Please keep us posted with your progress.

Best,
Heather
deleted-71949
Posts: 59
Joined: Mon Jun 22, 2009 3:55 pm
Occupation: Student: High School Senior
Project Question: Applying evolutionary algorithms to a Monte Carlo Tree Search
Project Due Date: September 20, 2013 (to allow for snail mail, etc.)
Project Status: I am conducting my experiment

Re: Bioinformatics Drug Design - Mutation and Procedure Ques

Post by deleted-71949 »

Thanks so much for the help, everyone!

Based on the article Genetic conversion of an SMN2 gene to SMN1: A novel
approach to the treatment of spinal muscular atrophy (http://www.img.cas.cz/bact/JournalClub/JC14April08.pdf)
and the article A degron created by SMN2 exon 7 skipping is a principal contributor to spinal muscular atrophy severity (http://genesdev.cshlp.org/content/24/5/438.full), there is a switch between the C and T base pair.
There are two SMN genes in humans, SMN1 and SMN2, both encoding the same ORF. The vast majority of SMA patients have homozygous SMN1 deletions and are sustained by one or more copies of SMN2. However, due to a C/T substitution at position 6 of exon 7 that does not change the encoded amino acid, the splicing of the SMN2 pre-mRNA incurs frequent (∼80%) exon 7 skipping. This produces an SMN protein (SMNΔ7) that lacks the normal C-terminal 16 amino acids and acquires instead four amino acids, EMLA, encoded by exon 8 (Le et al. 2005).
So there are amino acids being deleted (as well as fewer number added). However, I cannot find where the amino acid deletion takes place. I have not been able to find information on the "normal C-terminal 16 acids," except for articles that are the same/similar.

In addition, the first two results of the PDB search (http://www.rcsb.org/pdb/results/results ... d=D6049041) are the Tudor domain, which according to this article, http://www.ncbi.nlm.nih.gov/pubmed/11572858 don't have much to do with SMN.

However, I went to look at UniProt, and it seems like I could use protein sequences from there. (http://www.uniprot.org/uniprot/Q16637#section_seq). Are any of these sequences enough to constitute a protein model? Is it possible to generate one using a sequence?


Thanks,
blueswim
Curtopia
Posts: 1
Joined: Tue Jan 03, 2012 1:30 pm
Occupation: Executive
Project Question: N/A
Project Due Date: N/A
Project Status: Not applicable

Re: Bioinformatics Drug Design - Mutation and Procedure Ques

Post by Curtopia »

Gene-tools can also help you design a ASO.

From http://hmg.oxfordjournals.org/content/e ... 0.abstract

"Morpholino ASO Preparation: The MO sequence, numbered from the SMN2 exon 7 donor site (Figure 1),
was ATTCACTTTCATAATGCTGG (MWT=6754, Gene Tools). .... Morpholinos were resuspended in sterile 0.9%
sodium chloride, aliquoted, and mixed with Evans Blue (final concentration 0.04%). Three different molar
concentrations were prepared (High: 6mM=40.5μg/μL; Middle: 4mM=27μg/μL; Low: 2mM =13.5μg/μL). Stock
solutions were stored at -20oC, working solutions at 4oC. ...... 2μl of morpholino oligomer
was injected, yielding total doses per animal of 81μg (High), 54μg (Middle) and 27μg (Low)."

www.gene-tools.com - they have experts to help you out.

Have fun!!
deleted-71949
Posts: 59
Joined: Mon Jun 22, 2009 3:55 pm
Occupation: Student: High School Senior
Project Question: Applying evolutionary algorithms to a Monte Carlo Tree Search
Project Due Date: September 20, 2013 (to allow for snail mail, etc.)
Project Status: I am conducting my experiment

Re: Bioinformatics Drug Design - Mutation and Procedure Ques

Post by deleted-71949 »

Hi,
Thanks for the suggestion, but because of past deadlines, I will not be able to work morpholinos.

blueswim
deleted-71949
Posts: 59
Joined: Mon Jun 22, 2009 3:55 pm
Occupation: Student: High School Senior
Project Question: Applying evolutionary algorithms to a Monte Carlo Tree Search
Project Due Date: September 20, 2013 (to allow for snail mail, etc.)
Project Status: I am conducting my experiment

Re: Bioinformatics Drug Design - Mutation and Procedure Ques

Post by deleted-71949 »

Also, should I search for small molecules using a database?
I found a page that suggests different programs: http://www.click2drug.org/index.html

blueswim
deleted-71949
Posts: 59
Joined: Mon Jun 22, 2009 3:55 pm
Occupation: Student: High School Senior
Project Question: Applying evolutionary algorithms to a Monte Carlo Tree Search
Project Due Date: September 20, 2013 (to allow for snail mail, etc.)
Project Status: I am conducting my experiment

Re: Bioinformatics Drug Design - Mutation and Procedure Ques

Post by deleted-71949 »

After doing research, I found the C-terminal 16 amino acids were the last 16 amino acids of the SMN protein. And on top of that, the EMLA 4 amino acids are added. I know where the deletions and additions occur, thanks to this article: http://www.plosbiology.org/article/info ... io.0050073

So I guess I can start now...
I just need to figure out how to get the sequence into a protein model, and figure out how the databases need to be searched.

blueswim
deleted-71536
Former Expert
Posts: 895
Joined: Tue Sep 06, 2005 3:59 pm
Occupation: Professor
Project Question: How do different animals adapt to their environment?
Project Due Date: N/A
Project Status: Not applicable

Re: Bioinformatics Drug Design - Mutation and Procedure Ques

Post by deleted-71536 »

Hi blueswim,

I'm so glad you are making progress! As my friend suggested, Pymol (http://www.pymol.org/) is a great (and free!) protein visualization program. You'll need to play with it a bit, but it will visualize your sequences for you, with and without mutations.

Please let us know if you have more questions as you go along.

Best,
Heather
Locked

Return to “Grades 9-12: Life, Earth, and Social Sciences”