Abstract

Many scientists are currently very excited about CRISPR, as it has the potential to revolutionize gene editing. But what exactly is CRISPR and what does it do? CRISPR is a novel tool in gene editing that allows the modification of genetic DNA at specific target sites in many different organisms. Researchers have high hopes that this technology can, one day, cure genetic diseases, as mutated DNA sequences can easily be corrected. In this project, you will use CRISPR to mutate a DNA sequence yourself! You will not cure a genetic disease quite yet, but you will modify the genetic DNA of the bacterium Escherichia coli to make it resistant to the antibiotic streptomycin.

Objective

To investigate the relevance of a DNA template when using CRISPR to edit the genomic DNA of Escherichia coli to make it streptomycin resistant.

Introduction

Reliable and inexpensive gene editing, used either to "fix" genetic defects in patients or to introduce genomic changes for further study in a research lab, is a much-desired technology. Since its development around 2012, CRISPR (short for clustered regularly interspaced short palindromic repeats) systems have gained recognition as powerful gene editing techniques. The resources and videos provided in the Bibliography section cover much of the information on how CRISPR works. CRISPR harnesses the natural immune system bacteria used to fight off viruses. The antiviral defense mechanism is based on the incorporation of DNA fragments from viruses into the bacterial DNA. This part of the DNA is called the CRISPR array. Within the CRISPR array, the acquired virus DNA fragments are separated by conserved, short nucleotide sequence repeats (Figure 1). The bacteria can then use this acquired virus DNA to identify and defend themselves against new viral threats in the future.

Several different types of CRISPR systems have been identified, but the one most studied is the CRISPR-Cas9 system. In this system, the genes next to the CRISPR repeat-spacer array encode a unique defense mechanism consisting of a single-guide RNA and an endonuclease (Cas9), a protein that is able to cut double-stranded DNA. The single-guide RNA (sgRNA or gRNA) helps target the dangerous virus DNA, and the Cas9 endonuclease degrades foreign nucleic acids by inducing a double-strand break. The sgRNA contains one or more acquired CRISPR sequences from the CRISPR repeat-spacer array. In the event of a virus infection, the sgRNA combines with the Cas9 nuclease to build a sgRNA-Cas9 complex and guides it to the appropriate target in the virus DNA (Figure 2).

Because the CRISPR mechanism can cut anywhere in the DNA, the bacteria must protect its own DNA from being damaged. The PAM (protospacer adjacent motif) region is a short DNA sequence, and an essential targeting component that allows the bacteria to distinguish its own DNA from foreign DNA. The sgRNA will only adhere to and disable a DNA sequence that contains a PAM sequence nearby. The sgRNA locks onto the PAM sequence and starts unzipping the DNA double-strand to test if the sgRNA matches the target DNA. Once a matching sequence is found, the sgRNA binds to the target genomic site through complementary base pairing, and the Cas9 nuclease cuts the double-stranded virus DNA, inactivating the virus.

Researchers have now found a way to manipulate the nucleotide sequence of the sgRNA so the Cas9 system can target any DNA sequence for cleavage. Once the Cas9 nuclease cuts the target DNA, the cell's natural DNA repair mechanisms kick in. There are two main pathways within a cell that result in the repair of DNA double-strand breaks. The first pathway is the non-homologous end joining (NHEJ) pathway, which is error-prone and can lead to insertion or deletion mutations within the DNA. The second pathway is the homologous direct repair (HDR) mechanism, which allows for insertion of a specific DNA template (single or double-stranded) at the target site. To learn more details about both of these pathways, you can view the CRISPR-Cas9 Triggers DNA Repair Mechanism Simulation on LabXchange. Currently, the two most common applications of the CRISPR technology are the targeted mutation of specific genes resulting in functional gene knockouts, and the replacement of a gene variant with another. Both strategies harness the natural CRISPR mechanism. Gene knockouts and gene replacement have made it much easier to probe gene functions and establish causal linkages between genetic variations and biological phenotypes.

The CRISPR-Cas9 technology has been successfully used in bacterial and mammalian cells, allowing for the creation of transgenic animals with targeted mutations. Most CRISPR research has focused on treating diseases by introducing genetic changes into blood, lung, or brain cells. Researchers have high hopes that this technology will one day enable scientists to repair disease-causing gene variants in patients with certain genetic diseases. This approach is especially promising in diseases such as sickle cell anemia, cystic fibrosis, and Huntington's disease, each of which is linked to a single gene variant. In 2019, the first gene-editing clinical trials began, targeting patients with sickle cell anemia. In the future, CRISPR might also significantly impact agriculture and the environment, including their impact on human health. For instance, CRISPR can be used to modify crops to make them more drought- or pest-resistant, or eradicate disease-spreading insects, such as mosquitoes.

Although genome editing brings significant potential benefits, it also raises profound ethical questions. What CRISPR safety standards are appropriate? Where are the limits of this technology? Does gene editing bring us closer to "designer babies"? What about potential genetic discrimination? How can we grant equitable access to gene editing technologies? In 2018, Chinese researcher He Jiankui claimed to have edited the genomes of two human embryos, which then developed into two human babies, highlighting the need for ongoing public discourse to address these fundamental ethical issues related to CRISPR.

In this project, you will do a CRISPR gene editing experiment yourself! Specifically, you will use CRISPR to modify the genetic DNA of Escherichia coli so that it becomes streptomycin-resistant. Streptomycin is an antibiotic that binds the ribosome and prevents it from making proteins, stopping the bacteria from replicating and growing. In this project, your goal is to make a specific mutation in the ribosomal subunit protein rpsL that prevents streptomycin from binding it, allowing the bacteria to grow on streptomycin media. Your DNA modification needs to change a single DNA base so that the lysine amino acid at position 43 (K43) is turned to threonine. For this purpose, the kit includes two CRISPR plasmids and a specific DNA repair template that carries the desired DNA change. You will test if you can also achieve the desired mutation when doing the CRISPR reaction without the DNA repair template. Do you think it will work? Try this project to find out!

Terms and Concepts

• Gene editing
• CRISPR
• CRISPR array
• CRISPR-Cas9
• Single-guide RNA (sgRNA)
• Endonuclease (Cas9)
• sgRNA-Cas9 complex
• PAM (protospacer adjacent motif)
• DNA repair mechanism
• Non-homologous end joining (NHEJ) pathway
• Homologous direct repair (HDR) mechanism
• Gene knockout
• Gene replacement
• Escherichia coli
• Streptomycin
• Plasmid
• DNA repair template

Questions

• What are the main components involved in the CRISPR-Cas9 editing mechanism and what are their functions?
• Can you describe the sequence of events that happen on a molecular level during CRISPR-Cas9 editing?
• Which DNA repair pathway is preferred when you provide a DNA repair template? Which DNA repair pathway is preferred without a DNA repair template?

Materials and Equipment

• DIY Bacterial Gene Engineering CRISPR Kit, available from The ODIN. To get 10% off the purchase price of the kit, use the coupon code "buddies" at checkout. The kit includes:
  • LB Strep/Kan/Arab agar (Strep (50 μg/ml), Kan (25 μg/ml) and Arabinose (1 mM)) (1)
  • 250-mL glass bottle for pouring plates (1)
  • 10–100 μL variable volume adjustable pipette (1)
  • Box 1-200 μL pipette tips (1)
  • Petri dishes (14)
  • Microcentrifuge tube rack (1)
  • Inoculation loops (5)
  • Plate spreader (1)
  • Pairs of nitrile gloves in plastic bag (5)
  • Bag of microcentrifuge tubes (1)
  • 1.5-mL microcentrifuge tubes containing LB broth (5)
  • 50-mL centrifuge tube for measuring liquid volume (1)
  • 1-mL bacterial transformation buffer 25 mM CaCl₂, 10% PEG 8000 (1)
  • 55 μL of 100 ng/μL - Cas9 Plasmid Kan^r (1)
  • 55 μL of 100 ng/μL - gRNA Plasmid Amp^r (1)
  • 55 μL of 1 mM - template DNA (1)
    (Sequence: ATACTTTACGCAGCGCGGAGTTCGGTTTTGTAGGAGTGGTAGTATATACACGAGTACAT)
  • Non-pathogenic E. coli bacteria freeze-dried tube (DH5α) (1)
  • Sterile water tube (1)
• Permanent marker
• Lab notebook

Experimental Procedure

Variations

Careers

If you like this project, you might enjoy exploring these related careers:

Related Links

• Science Fair Project Guide
• Other Ideas Like This
• Biotechnology Project Ideas
• Genetic Engineering Project Ideas
• My Favorites

Cite This Page

General citation information is provided here. Be sure to check the formatting, including capitalization, for the method you are using and update your citation, as needed.

MLA Style

APA Style