Abstract
Many scientists are currently very excited about CRISPR, as it has the potential to revolutionize gene editing. But what exactly is CRISPR and what does it do? CRISPR is a novel tool in gene editing that allows the modification of genetic DNA at specific target sites in many different organisms. Researchers have high hopes that this technology can, one day, cure genetic diseases, as mutated DNA sequences can easily be corrected. In this project, you will use CRISPR to mutate a DNA sequence yourself! You will not cure a genetic disease quite yet, but you will modify the genetic DNA of the bacterium Escherichia coli to make it resistant to the antibiotic streptomycin.Summary

Objective
To investigate the relevance of a DNA template when using CRISPR to edit the genomic DNA of Escherichia coli to make it streptomycin resistant.
Introduction
Reliable and inexpensive gene editing, used either to "fix" genetic defects in patients or to introduce genomic changes for further study in a research lab, is a much-desired technology. Since its development around 2012, CRISPR (short for clustered regularly interspaced short palindromic repeats) systems have gained recognition as powerful gene editing techniques. The resources and videos provided in the Bibliography section cover much of the information on how CRISPR works. CRISPR harnesses the natural immune system bacteria used to fight off viruses. The antiviral defense mechanism is based on the incorporation of DNA fragments from viruses into the bacterial DNA. This part of the DNA is called the CRISPR array. Within the CRISPR array, the acquired virus DNA fragments are separated by conserved, short nucleotide sequence repeats (Figure 1). The bacteria can then use this acquired virus DNA to identify and defend themselves against new viral threats in the future.

Figure 1. Schematic view of a CRISPR repeat-spacer array.
Several different types of CRISPR systems have been identified, but the one most studied is the CRISPR-Cas9 system. In this system, the genes next to the CRISPR repeat-spacer array encode a unique defense mechanism consisting of a single-guide RNA and an endonuclease (Cas9), a protein that is able to cut double-stranded DNA. The single-guide RNA (sgRNA or gRNA) helps target the dangerous virus DNA, and the Cas9 endonuclease degrades foreign nucleic acids by inducing a double-strand break. The sgRNA contains one or more acquired CRISPR sequences from the CRISPR repeat-spacer array. In the event of a virus infection, the sgRNA combines with the Cas9 nuclease to build a sgRNA-Cas9 complex and guides it to the appropriate target in the virus DNA (Figure 2).
Because the CRISPR mechanism can cut anywhere in the DNA, the bacteria must protect its own DNA from being damaged. The PAM (protospacer adjacent motif) region is a short DNA sequence, and an essential targeting component that allows the bacteria to distinguish its own DNA from foreign DNA. The sgRNA will only adhere to and disable a DNA sequence that contains a PAM sequence nearby. The sgRNA locks onto the PAM sequence and starts unzipping the DNA double-strand to test if the sgRNA matches the target DNA. Once a matching sequence is found, the sgRNA binds to the target genomic site through complementary base pairing, and the Cas9 nuclease cuts the double-stranded virus DNA, inactivating the virus.

Figure 2. The single-guide RNA combines with Cas9 and guides the nuclease to the target within a double-stranded genomic DNA. The sgRNA locks onto the DNA target directly next to the required PAM sequence. If the sgRNA matches with the target DNA, the Cas9 nuclease cuts the DNA double-strand 3 base pairs upstream of the PAM motif. (Image credit: Marius Walter [CC BY-SA 4.0], Wikimedia Commons, 2017)
Researchers have now found a way to manipulate the nucleotide sequence of the sgRNA so the Cas9 system can target any DNA sequence for cleavage. Once the Cas9 nuclease cuts the target DNA, the cell's natural DNA repair mechanisms kick in. There are two main pathways within a cell that result in the repair of DNA double-strand breaks. The first pathway is the non-homologous end joining (NHEJ) pathway, which is error-prone and can lead to insertion or deletion mutations within the DNA. The second pathway is the homologous direct repair (HDR) mechanism, which allows for insertion of a specific DNA template (single or double-stranded) at the target site. To learn more details about both of these pathways, you can view the CRISPR-Cas9 Triggers DNA Repair Mechanism Simulation on LabXchange. Currently, the two most common applications of the CRISPR technology are the targeted mutation of specific genes resulting in functional gene knockouts, and the replacement of a gene variant with another. Both strategies harness the natural CRISPR mechanism. Gene knockouts and gene replacement have made it much easier to probe gene functions and establish causal linkages between genetic variations and biological phenotypes.
The CRISPR-Cas9 technology has been successfully used in bacterial and mammalian cells, allowing for the creation of transgenic animals with targeted mutations. Most CRISPR research has focused on treating diseases by introducing genetic changes into blood, lung, or brain cells. Researchers have high hopes that this technology will one day enable scientists to repair disease-causing gene variants in patients with certain genetic diseases. This approach is especially promising in diseases such as sickle cell anemia, cystic fibrosis, and Huntington's disease, each of which is linked to a single gene variant. In 2019, the first gene-editing clinical trials began, targeting patients with sickle cell anemia. In the future, CRISPR might also significantly impact agriculture and the environment, including their impact on human health. For instance, CRISPR can be used to modify crops to make them more drought- or pest-resistant, or eradicate disease-spreading insects, such as mosquitoes.
Although genome editing brings significant potential benefits, it also raises profound ethical questions. What CRISPR safety standards are appropriate? Where are the limits of this technology? Does gene editing bring us closer to "designer babies"? What about potential genetic discrimination? How can we grant equitable access to gene editing technologies? In 2018, Chinese researcher He Jiankui claimed to have edited the genomes of two human embryos, which then developed into two human babies, highlighting the need for ongoing public discourse to address these fundamental ethical issues related to CRISPR.
In this project, you will do a CRISPR gene editing experiment yourself! Specifically, you will use CRISPR to modify the genetic DNA of Escherichia coli so that it becomes streptomycin-resistant. Streptomycin is an antibiotic that binds the ribosome and prevents it from making proteins, stopping the bacteria from replicating and growing. In this project, your goal is to make a specific mutation in the ribosomal subunit protein rpsL that prevents streptomycin from binding it, allowing the bacteria to grow on streptomycin media. Your DNA modification needs to change a single DNA base so that the lysine amino acid at position 43 (K43) is turned to threonine. For this purpose, the kit includes two CRISPR plasmids and a specific DNA repair template that carries the desired DNA change. You will test if you can also achieve the desired mutation when doing the CRISPR reaction without the DNA repair template. Do you think it will work? Try this project to find out!
Terms and Concepts
- Gene editing
- CRISPR
- CRISPR array
- CRISPR-Cas9
- Single-guide RNA (sgRNA)
- Endonuclease (Cas9)
- sgRNA-Cas9 complex
- PAM (protospacer adjacent motif)
- DNA repair mechanism
- Non-homologous end joining (NHEJ) pathway
- Homologous direct repair (HDR) mechanism
- Gene knockout
- Gene replacement
- Escherichia coli
- Streptomycin
- Plasmid
- DNA repair template
Questions
- What are the main components involved in the CRISPR-Cas9 editing mechanism and what are their functions?
- Can you describe the sequence of events that happen on a molecular level during CRISPR-Cas9 editing?
- Which DNA repair pathway is preferred when you provide a DNA repair template? Which DNA repair pathway is preferred without a DNA repair template?
Bibliography
- Ran F.A. et al. (2013). Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 8(11):2281-23-8. Retrieved September 1, 2020.
- Hsu P.D. et al. (2014). Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157(6):1262-1278. Retrieved September 1, 2020.
- Knot, G.J., Doudna, J.A. (2018). https://pubmed.ncbi.nlm.nih.gov/30166482/>CRISPR-Cas guides the future of genetic engineering. Science. 361(6405):866-869. Retrieved September 1, 2020.
- Synthego. (n.d.). Sickle Cell Gene Therapy with CRISPR. Retrieved September 1, 2020.
- Saey, T.H. (2019). CRISPR enters its first human trials. Science News. Retrieved September 1, 2020.
- Li, J.R., et al. (2019). Experiments that led to the first gene-edited babies: the ethical failings and the urgent need for better governance. J Zhejiang Univ-Sci B (Biomed & Biotechnol) 20(1):32-38. Retrieved September 1, 2020.
- ABC News (Australia). (2018). Why gene editing is so controversial. Retrieved September 1, 2020.
Materials and Equipment
- DIY Bacterial Gene Engineering CRISPR Kit,
available from The ODIN. To get 10% off the purchase price of the kit, use the coupon code "buddies" at checkout. The kit includes:
- LB Strep/Kan/Arab agar (Strep (50 μg/ml), Kan (25 μg/ml) and Arabinose (1 mM)) (1)
- 250-mL glass bottle for pouring plates (1)
- 10–100 μL variable volume adjustable pipette (1)
- Box 1-200 μL pipette tips (1)
- Petri dishes (14)
- Microcentrifuge tube rack (1)
- Inoculation loops (5)
- Plate spreader (1)
- Pairs of nitrile gloves in plastic bag (5)
- Bag of microcentrifuge tubes (1)
- 1.5-mL microcentrifuge tubes containing LB broth (5)
- 50-mL centrifuge tube for measuring liquid volume (1)
- 1-mL bacterial transformation buffer 25 mM CaCl₂, 10% PEG 8000 (1)
- 55 μL of 100 ng/μL - Cas9 Plasmid Kanr (1)
- 55 μL of 100 ng/μL - gRNA Plasmid Ampr (1)
- 55 μL of 1 mM - template DNA (1)
(Sequence: ATACTTTACGCAGCGCGGAGTTCGGTTTTGTAGGAGTGGTAGTATATACACGAGTACAT) - Non-pathogenic E. coli bacteria freeze-dried tube (DH5α) (1)
- Sterile water tube (1)
- Permanent marker
- Lab notebook
Experimental Procedure

Bacterial Safety
Bacteria are all around us in our daily lives and the vast majority of them are not harmful. However, for maximum safety, all bacterial cultures should always be treated as potential hazards. This means that proper handling, cleanup, and disposal are necessary. Below are a few important safety reminders.
- Keep your nose and mouth away from tubes, pipettes, or other tools that come in contact with bacterial cultures, in order to avoid ingesting or inhaling any bacteria.
- Make sure to wash your hands thoroughly after handling bacteria.
- Proper Disposal of Bacterial Cultures
- Bacterial cultures, plates, and disposables that are used to manipulate the bacteria should be soaked in a 10% bleach solution (1 part bleach to 9 parts water) for 1–2 hours.
- Use caution when handling the bleach, as it can ruin your clothes if spilled, and any disinfectant can be harmful if splashed in your eyes.
- After bleach treatment is completed, these items can be placed in your normal household garbage.
- Cleaning Your Work Area
- At the end of your experiment, use a disinfectant, such as 70% ethanol, a 10% bleach solution, or a commercial antibacterial kitchen/bath cleaning solution, to thoroughly clean any surfaces you have used.
- Be aware of the possible hazards of disinfectants and use them carefully.
For health and safety reasons, science fairs regulate what kinds of biological materials can be used in science fair projects. You should check with your science fair's Scientific Review Committee before starting this experiment to make sure your science fair project complies with all local rules. Many science fairs follow Regeneron International Science and Engineering Fair (ISEF) regulations. For more information, visit these Science Buddies pages: Project Involving Potentially Hazardous Biological Agents and Scientific Review Committee. You can also visit the webpage ISEF Rules & Guidelines directly.
The ODIN kit should provide enough materials to do five CRISPR reactions and comes with a kit manual that includes the instructions for how to do the experiment. You can also access the kit manual online. In this experiment, you will use CRISPR to modify the genetic DNA of Escherichia coli so it becomes streptomycin-resistant. You will test if the presence of the DNA repair template is necessary to achieve the desired DNA mutation to make the bacteria streptomycin-resistant.
- When you receive the kit, make sure to store all the perishables in the refrigerator or freezer, as advised in the kit manual.
- Follow the kit instructions to do the experiment. Prepare enough bacterial transformation mix tubes to do four CRISPR experiments.
- When you come to the transformation and CRISPR step, you will test the CRISPR reaction with and without the DNA template. Do each reaction in duplicate to make sure your results are reproducible. Prepare the CIRSPR reactions according to Table 1. Based on what you know about CRISPR, do you think the reaction will also work without a DNA repair template?
| Additions to Bacteria Transformation Mix | With DNA Repair Template | Without DNA Repair Template |
|---|---|---|
| Cas9 plasmid | 10 μL | 10 μL |
| gRNA plasmid | 10 μL | 10 μL |
| Template DNA | 10 μL | - |
- Once you have prepared your CRISPR reactions, continue to follow the instructions in the kit manual to the end. Make sure to label your plates so you remember which cells you spread on which plate.
- Do not forget to take pictures of your plates for your display board.
- When you are done, make sure to inactivate your modified bacteria with 5-10% bleach before disposal, as directed in the kit manual.
- To analyze and interpret your results, go through the following questions and try to answer each one.
- When you look at your plates, do you see little white colonies growing? What does this mean?
- Do colonies grow on every plate or only on some? Did you expect these results? Why or why not?
- Did you get the desired DNA mutation that makes E. coli streptomycin-resistant without a DNA repair template? How can you tell?
- If you did not see any colonies on the plates without the DNA template, does that mean the CRISPR reaction did not work? Why or why not?
- What difference does the presence of a DNA repair template make in a CRISPR reaction? Does the Cas9 protein still cut the DNA at its target site?
- Which DNA repair pathway is favored in the presence of a DNA repair template; which one without? Tip: You can review both of the DNA repair pathways in the CRISPR-Cas9 Triggers DNA Repair Mechanism Simulation on LabXchange.
- Can you make a schematic drawing of what happens to the cut DNA for each of the two DNA repair pathways?
- What could you do to find out if and how the CRISPR reaction changed the DNA of the E.coli cells without the DNA repair template?
Ask an Expert
Global Goals
The United Nations Sustainable Development Goals (UNSDGs) are a blueprint to achieve a better and more sustainable future for all.
Variations
- Design your own guide RNA for this project by following the instructions on the last page of the kit manual. Even if you cannot use your designed gRNA in the experiment, think about reasons why one guide RNA might work better than another.
- In this project, you used the CRISPR tool to make E. coli streptomycin-resistant. You can also make E. coli glow by inserting a green fluorescent protein into its DNA! Science Buddies' project Genetically Modified Organisms: Create Glowing Bacteria! will show you how.
- To get a deeper understanding of the molecular mechanism of the CRISPR-Cas9 system, you can review the CUT! How Does CRISPR Work? lesson plan and create a stop-motion animation of the molecular mechanism of CRISPR-Cas9.
- Do some more research on the bioethical implications of CRISPR and gene editing. What regulations do you think make sense for the CRISPR technology?
Careers
If you like this project, you might enjoy exploring these related careers:











